Search results for " patologia"
showing 10 items of 779 documents
Primi studi su Biscogniauxia mediterranea in Sicilia occidentale
2009
È stata condotta un’indagine su un diffuso deperimento delle querce, all’interno di un’area della riserva naturale orientata “Bosco della Ficuzza, Rocca Busambra, Bosco del Cappelliere e Gorgo del Drago”, nelle contrade Pulpito del Re e S. Barbara (Corleone, PA). Campioni di organi sinto-matici e di strutture miceliari associate alle alterazioni sono stati sottoposti alle opportune analisi. I saggi di laboratorio hanno consentito di isolare colonie fungine identificate con metodi tradizionali e molecolari come appartenenti a B. mediterranea. Tali ceppi hanno mostrato una variabilità morfologica in relazione all’ospite e all’epoca stagionale. I saggi di inoculazione artificiale hanno evidenz…
Latifoglie in Sicilia: un laboratorio di casi fitopatologici
2009
Si riportano alcuni casi fitopatologici osservati su differenti latifoglie, in vari ambienti boschivi siciliani. Le indagini, in particolare, sono state rivolte all’isolamento e all’identificazione dei mi-crorganismi fungini associati alle alterazioni. In alcuni casi, inoltre, mediante saggi d’inoculazione artificiale, è stata valutata la loro eventuale patogenicità. Tra i numerosi taxa identificati, alcuni, noti come parassiti di debolezza, hanno mostrato una spiccata attitudine fitopatogena su ospiti sani e stressati. Gli studi condotti, evidenziando l’incidenza e la severità di alcune malattie, accertano un generale stato di sofferenza delle latifoglie forestali, dovuto, probabilmente, a…
A continuous infusion of a minor histocompatibility antigen-immunodominant peptide induces a delay of male skin graft rejection.
2009
Abstract We previously reported that an inhibition of antigen-specific Interferon-γ release and cytotoxicity occurs after a continuous infusion of an HY immunodominant peptide although this treatment is not able to cause a significant delay of male skin grafts rejection. In vivo administration of high doses of an HY peptide, through mini-osmotic pumps, in naive female mice was used to study the effects on the male skin grafts rejection. A continuous infusion of 1 mg of an HY peptide induces a significant delay of male skin graft rejection. In vitro HY-specific Interferon-γ release was inhibited adding peptide-specific suppressor cells: the ability to inhibit Interferon-γ release was evident…
Human NK cells selective targeting of colon cancer-initiating cells: a role for natural cytotoxicity receptors and MHC class I molecules
2013
Abstract Tumor cell populations have been recently proposed to be composed of two compartments: tumor-initiating cells characterized by a slow and asymmetrical growth, and the “differentiated” cancer cells with a fast and symmetrical growth. Cancer stem cells or cancer-initiating cells (CICs) play a crucial role in tumor recurrence. The resistance of CICs to drugs and irradiation often allows them to survive traditional therapy. NK cells are potent cytotoxic lymphocytes that can recognize tumor cells. In this study, we have analyzed the NK cell recognition of tumor target cells derived from the two cancer cell compartments of colon adenocarcinoma lesions. Our data demonstrate that freshly p…
γδ T cell-based anticancer immunotherapy: Progress and possibilities
2015
IDENTIFICATION OF THE MAIN DESTRUCTIVE PLANT-VIRUS-DISEASES OF HORTICULTURAL CROPS IN SICILY AND DEVELOPMENT OF NEW DIAGNOSTIC TECHNIQUES
2014
Are the leukocyte telomere length attrition and telomerase activity alteration potential predictor biomarkers for sporadic TAA in aged individuals?
2014
A large variability in occurrence, complications, and age/gender manifestations characterizes individual susceptibility of sporadic thoracic aortic aneurysms (TAA), even in subjects with the same risk factor profiles. The reasons are poorly understood. On the other hand, TAA pathophysiology mechanisms remain unclear than those involved in abdominal aorta aneurysms. However, recent evidence is suggesting a crucial role of biological ageing in inter-individual risk variation of cardiovascular diseases, including sporadic TAA. Biological age rather than chronological age is a better predictor of vascular risk. Relevant assumptions support this concept. In confirming this evidence and our preli…
Pseudomonas corrugata crpCDE is part of the cyclic lipopeptide corpeptin biosynthetic gene cluster and is involved in bacterial virulence in tomato a…
2014
Summary: Pseudomonas corrugataCFBP 5454 produces two kinds of cyclic lipopeptides (CLPs), cormycin A and corpeptins, both of which possess surfactant, antimicrobial and phytotoxic activities. In this study, we identified genes coding for a putative non-ribosomal peptide synthetase and an ABC-type transport system involved in corpeptin production. These genes belong to the same transcriptional unit, designated crpCDE. The genetic organization of this locus is highly similar to other PseudomonasCLP biosynthetic clusters. Matrix-assisted laser desorption ionization-time of flight-mass spectrometry (MALDI-TOF-MS) analysis revealed that transporter and synthetase genomic knock-out mutants were u…
CD95 death-inducing signaling complex formation and internalization occur in lipid rafts of type I and type II cells
2004
We investigated the membrane localization of CD95 in type I and type II cells, which differ in their ability to recruit and activate caspase-8. We found that CD95 was preferentially located in lipid rafts of type I cells, while it was present both in raft and non-raft plasma membrane sub-domains of type II cells. After stimulation, CD95 located in phospholipid-rich plasma membrane was recruited to lipid rafts in both types of cells. Similarly, CD95 cross-linking resulted in caspase-independent translocation of FADD/MORT1 and caspase-8 to the lipid rafts, which was prevented by a death domain-defective receptor. CD95 internalization was then rapid in type I and delayed in type II cells and s…
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…