6533b828fe1ef96bd128798d
RESEARCH PRODUCT
Globularia nudicaulis, a new host of Cucumber mosaic virus
Maria Grazia BellardiS. CugnataSalvatore Davinosubject
biologyHost (biology)Nicotiana tabacumfungiCMVRT-PCRSettore AGR/12 - Patologia Vegetalefood and beveragesvirus diseasesSingle-strand conformation polymorphismPlant ScienceHorticulturebiology.organism_classificationVirologySSCPCucumber mosaic virusPlant virusGeneticsMovement proteinGLOBULARIA NUDICAULISCHARACTERIZATIONAgronomy and Crop ScienceGeneCucumisdescription
) is a perennial, foundnaturally on European mountains at altitudes between 900 and 2000 m.In June 2004, G. nudicaulis plants, with a yellow mosaic and/or variega-tion on malformed leaves, were noted among plant species cultivated in theBotanical Garden at Bologna University, Italy. No elongated virus-likeparticles were observed in affected-leaf extracts by transmission electronmicroscopy using a leaf dip method. By applying a protein A sandwichenzyme-linked immunosorbent assay (PAS-ELISA) technique ( Edwards Csystemic symptoms were observed in Nicotiana tabacum , N. benthamiana ,N. glutinosa, N. clevelandii and Capsicum annuum, and Cucumis sativusand C. melo. Reverse transcription-polymerase chain reaction (RT-PCR)and single-strand conformation polymorphism (SSCP) were employed tocharacterize the CMV isolate. Total RNA was extracted from affected G.nudicaulis leaf samples with a RNeasy Plant Minikit (Qiagen) accordingto the manufacturer’s instructions. RT-PCR was carried out using specificprimers for the movement protein gene of RNA3 of CMV (forward MP +CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt,and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938ntto 959nt; Lin et al., 2004). All samples yielded DNA fragments ofthe expected size: 841 bp. PCR products were then analysed by SSCP toidentify specific sequence variants and compare genetic relationships withother CMV isolates from the Botanical Garden (MGB & SD, unpublishedresults).The results showed a sequence variant that was different from otherlocal CMV isolates, indicating that CMV isolate G in G. nudicaulis is anew accession in this location. This is the first time that CMV has beenisolated from G. nudicaulis.ReferencesEdwards ML, Cooper JI, 1985. Plant virus detection using a new form of indirect ELISA.
| year | journal | country | edition | language |
|---|---|---|---|---|
| 2006-08-01 |