Search results for " Sistematica"
showing 10 items of 811 documents
Efficacia delle AMP nella conservazione della biodiversità: i popolamenti a Cystoseira nell’AMP “Capo Gallo-Isola delle Femmine” (Pa)
2008
Scopo dello studio è quello di i) valutare lo stato di salute e di conservazione delle comunità a Cystoseira presenti nell’A.M.P. “Capo Gallo-Isola delle Femmine” ii) confrontarlo con i dati storici, iii) confrontarlo con quello di siti di controllo al di fuori dell’A.M.P. e quindi iv) verificare il successo/efficacia dell’A.M.P nel proteggere e mantenere queste comunità e quindi la biodiversità di questi ecosistemi dalla sempre più intensa pressione antropica. Lo studio viene condotto, in particolare, sui popolamenti a Cystoseira dell’infralitorale di siti chiave all’interno della Riserva (Zone A, B e C) e di due siti di controllo: Punta Priola (PA) e Monte Cofano (TP). Lo stato di conserv…
Phytochemical Constituents, Antioxidant Activity, and Toxicity Assessment of the Aerial Part Extracts from the Infraspecific Taxa of Matthiola frutic…
2021
In a project designed to investigate the specific and infraspecific taxa of Matthiola endemic to Sicily (Italy) as new potential sources of bioactive compounds in this work, the infraspecific taxa of Matthiola fruticulosa were studied, namely, subsp. fruticulosa and subsp. coronopifolia. HPLC–PDA/ESI–MS and SPME–GC/MS analyses of hydroalcoholic extracts obtained from the aerial parts of the two subspecies led to the detection of 51 phenolics and 61 volatile components, highlighting a quite different qualitative–quantitative profile. The antioxidant properties of the extracts were explored through in vitro methods: 1,1-diphenyl-2-picrylhydrazyl (DPPH), reducing power and Fe2+ chelating activ…
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Typification of 14 names in the Dianthus virgineus group (Caryophyllaceae)
2021
The nomenclature of 14 taxa from Central and Southern Europe within the Dianthus virgineus group is discussed. Dianthus aggericola Jord., D. collivagus Jord., D. consimilis Jord., D. orophilus Jord., D. saxicola Jord., D. juratensis Jord. are here lectotypified by specimens from the Jordan herbarium in LY, while D. godronianus Jord. by a specimen in P. Dianthus subacaulis Vill. is neotypified by a specimen collected on Mont Ventoux (S. France) and housed in MPU. For D. sylvestris Wulfen, a lectotype is here designated and its previous neotypification is discussed. Dianthus caryophyllus var. tenuifolius Moris, D. caryophyllus f. minor Moris and D. sylvestris var. garganicus Ten. are lectotyp…
Primo contributo alla filogenesi dei diaptomidi paleartico-occidentali (Copepoda, Calanoida)
2013
La Dieta mediterranea per tutto l'anno
2016
La promozione e la valorizzazione della Dieta Mediterranea come strumento di prevenzione primaria delle principali malattie cardiovascolari, metaboliche, oncologiche e degenerative è l’obiettivo di Idimed e questo opuscolo è uno degli strumenti della sua strategia di divulgazione. Idimed, fedele alla sua impostazione sistemica, ha sempre parlato di alimentazione a 360°, integrando i diversi aspetti del fenomeno: culturali, salutistici, agronomici, botanici, gastronomici, psicologici, relazionali e della comunicazione. Far conoscere l’alimento, descrivere la realizzazione della ricetta, fornire indicazioni su quantità, uso dei condimenti, specificità della tradizione e raccomandazioni saluti…
Diversity of Draba L. sect. Aizopsis DC. (Brassicaceae) in Sicily
2008
Karyological data of four geophytes native to Tunisia
2021
Chromosome numbers were studied in four geophytes collected in Tunisia. Allium pallens was collected from Zembra island, N of Tunisia, while Drimia purpurascens, Oncostema peruvianum and Pancratium foetidum from continental Tunisia. The chromosome numbers found for Allium pallens, Drimia purpurascens, and Oncostema peruvianum coincides with the previous reports obtained from other Mediterranean populations. The chromosome number 2n = 22, found on material from Toujane is the first reported for Pancratium foetidum.
Taxonomic investigation on Allium hirtovaginum group (Amaryllidaceae) from East Mediterranean area
2021
Within taxonomic studies on Allium sect. Codonoprasum from Mediterranean flora, populations belonging to A. hirtovaginum Candargy group were examined. Based on field investigation and herbarium surveyes, this group is represented by very critical and not well known taxa, distributed in the East Mediterranean, showing a marked morphological variability. Currently, the species referable to this group in addition to A. hirtovaginum are also A. pilosum Sibth. & Sm., A. aeginiense Brullo, Giusso & Terrasi and A. nerimaniae Koçyiğit & Kaya. Besides, other 13 species are here described as new to science, they are A. pythagoricum, A. pignattii, A. hippocraticum, A. abanticum, A. velutin…
The species-specific monitoring protocols for plant species of Community interest in Italy
2017
The results of a project for the identification of species-specific monitoring protocols for the Italian plant species protected under the Habitats Directive (Annexes II/IV/V) are presented. The project led to the development of 118 monitoring factsheets, providing an operational guidance for 107 vascular taxa, 10 bryophytes and 1 lichen taxon. Each factsheet includes information on the species (distribution, biology, ecology, conservation status, threats, etc.) and the description of field methodologies for the detection of the two main reporting parameters, i.e. population size and habitat quality. Practical information to plan field activities are also given. Protocols were designed to a…