Search results for "Botanica"

showing 10 items of 1665 documents

Ultrastructural and histochemical analysis reveals ethylene-induced responses underlying reduced peel collapse in detached citrus fruit

2010

Fruits from many citrus cultivars develop depressed areas in the flavedo (outer part of the peel) and albedo (inner part) following detachment. Although ultrastructural analysis may provide important information about multiple plant responses to stresses and external stimuli at the cell and tissue levels, and despite the proved efficacy of ethylene in reducing peel damage in citrus fruit, cytological responses of this horticultural crop to protective ethylene concentrations have not yet been reported. We show that applying high ethylene levels (2 mu L L(-1) for 14 days) causes sublethal stress as it favored the alteration of cuticle, vacuole, middle lamella and primary wall, especially in t…

CyclopropanesCitrusHistologyEthylenefood.ingredientPectinStarchCuticleBOTANICAVacuoleBiologyPolysaccharideElectron Microscopy Service of the UPVchemistry.chemical_compoundfoodMicroscopy Electron TransmissionPolysaccharidesBotanyInstrumentationMiddle lamellachemistry.chemical_classificationBIOLOGIA VEGETALfood and beveragesStarchEthylenesCell ultrastructurePectinMedical Laboratory TechnologyHorticulturechemistryFruitPeel damageUltrastructureAnatomyCross-protection
researchProduct

Efficacia delle AMP nella conservazione della biodiversità: i popolamenti a Cystoseira nell’AMP “Capo Gallo-Isola delle Femmine” (Pa)

2008

Scopo dello studio è quello di i) valutare lo stato di salute e di conservazione delle comunità a Cystoseira presenti nell’A.M.P. “Capo Gallo-Isola delle Femmine” ii) confrontarlo con i dati storici, iii) confrontarlo con quello di siti di controllo al di fuori dell’A.M.P. e quindi iv) verificare il successo/efficacia dell’A.M.P nel proteggere e mantenere queste comunità e quindi la biodiversità di questi ecosistemi dalla sempre più intensa pressione antropica. Lo studio viene condotto, in particolare, sui popolamenti a Cystoseira dell’infralitorale di siti chiave all’interno della Riserva (Zone A, B e C) e di due siti di controllo: Punta Priola (PA) e Monte Cofano (TP). Lo stato di conserv…

Cystoseira Aree marine Protette conservazione Mar MediterraneoSettore BIO/02 - Botanica Sistematica
researchProduct

Polysaccharides from Pleurotus eryngii var. elaeoselini (Agaricomycetes), a New Potential Culinary-Medicinal Oyster Mushroom from Italy.

2020

Three water-soluble glucans (PELPS-A1, PELPS-A2, and PELPS-A3) purified from the hot water extract of the basidiomata of an edible mushroom Pleurotus eryngii var. elaeoselini by chromatography on DEAE-cellulose 32 and Sephadex G-100 column were found to consist of only D-glucose as monosaccharide constituent. Structural investigation was carried out by acid hydrolysis, periodate oxidation, and NMR experiments (1H-NMR, 13C-NMR, DQF-COSY, TOCSY, ROESY, HMQC, and HMBC). On the basis of these experiments, the structures of the repeating unit of the three isolated polysaccharides were established as follows: (1) PELPS-A1: {[→3)-α-D-Glcp-(1→]3→4)-α-D-Glcp-(1→2)-α-D-Glcp-(1→6)-α-D-Glcp-(1[→6)-β-D-…

DPPH assayAntioxidantMagnetic Resonance SpectroscopyDPPHmedicine.medical_treatmentpolysaccharidesantioxidant activityPolysaccharidePleurotusApplied Microbiology and BiotechnologyAntioxidantschemistry.chemical_compoundDrug Discoverymedicinehydroxyl radical scavenging activityMonosaccharidePleurotus eryngiiPleurotus eryngii var. elaoseliniGlucansPharmacologychemistry.chemical_classificationMushroombiologymedicinal mushroomsHydroxyl Radicalbiology.organism_classificationPleurotus eryngii var. elaoselini polysaccharides antioxidant activity DPPH assay hydroxyl radical scavenging activity medicinal mushroomsEdible mushroomchemistrySettore BIO/03 - Botanica Ambientale E ApplicataHydroxyl radicalNuclear chemistryInternational journal of medicinal mushrooms
researchProduct

Phytochemical Constituents, Antioxidant Activity, and Toxicity Assessment of the Aerial Part Extracts from the Infraspecific Taxa of Matthiola frutic…

2021

In a project designed to investigate the specific and infraspecific taxa of Matthiola endemic to Sicily (Italy) as new potential sources of bioactive compounds in this work, the infraspecific taxa of Matthiola fruticulosa were studied, namely, subsp. fruticulosa and subsp. coronopifolia. HPLC–PDA/ESI–MS and SPME–GC/MS analyses of hydroalcoholic extracts obtained from the aerial parts of the two subspecies led to the detection of 51 phenolics and 61 volatile components, highlighting a quite different qualitative–quantitative profile. The antioxidant properties of the extracts were explored through in vitro methods: 1,1-diphenyl-2-picrylhydrazyl (DPPH), reducing power and Fe2+ chelating activ…

DPPHPharmaceutical Sciencebiological activityBrine shrimpMatthiolaSubspecies01 natural sciencesAnalytical Chemistry03 medical and health scienceschemistry.chemical_compoundQD241-441Biological activity; Chemical composition; Matthiola fruticulosa; Native plants; Natural resource; Sicily; Animals; Antioxidants; Artemia; Brassicaceae; Larva; Phytochemicals; Plant Extracts; Sicily; Toxicity Tests.Drug Discoverychemical compositionBioassaySettore BIO/15 - Biologia FarmaceuticaPhysical and Theoretical ChemistrySicily030304 developmental biology0303 health sciencesbiologyTraditional medicineSettore BIO/02 - Botanica Sistematica<i>Matthiola fruticulosa</i>Organic ChemistryBrassicaceaenative plantsnative plantbiology.organism_classificationnatural resource0104 chemical sciences010404 medicinal & biomolecular chemistrychemistryPhytochemicalChemistry (miscellaneous)Matthiola fruticulosaMolecular MedicineArtemia salinaMolecules
researchProduct

VegItaly: Technical features, crucial issues and some solutions

2012

VegItaly is at present the largest Italian vegetation database. It is the result of a collaborative project aspiring to represent a major reference for the Italian vegetation scientists. The paper emphasizes its benefits for phytosociological data management and describes the solutions adopted to solve several technical problems, like the treatment of different vegetation stratification systems, the conversion of vegetation cover values, taxonomic and syntaxonomic issues, data import and access. The structure of the taxonomic list produced to support the storing of data is described. It allows an easy management of synonymic relationships and is constantly updated according to new publicati…

Data sharing; Ecoinformatics; Italian vegetation database; Phytosociology; Syntaxonomy; Taxonomic listVegetation plot; Forestry; Ecology Evolution Behavior and Systematics; Ecology; Plant ScienceEcologyEvolutionDATABASEdata sharingItalian vegetation databasephytosociologyForestrydata sharing ecoinformatics Italian vegetation database phytosociology syntaxonomy taxonomic list vegetation plotPlant Scienceecoinformaticstaxonomic listBehavior and Systematicsvegetation sciencedata sharing; ecoinformatics; italian vegetation database; phytosociology; syntaxonomy; taxonomic list; taxonomic listvegetation plot; vegetation plotSettore BIO/03 - Botanica Ambientale E Applicatasyntaxonomytaxonomic listvegetation plotvegetation plot
researchProduct

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Nomi di piante e nomi di santi. San Giovanni nella lessicografia botanica siciliana

2022

A Mario Alinei si deve l’idea che alcune porzioni del lessico della nostra lingua siano più conservative di altre e che esse manifestino traccia, nelle circostanze più fortunate, delle diverse stratificazioni iconimiche prodottesi secolarmente. Il contributo rintraccia, nella lessicografia dialettale siciliana, i tipi lessicali legati alla agiofitonimia, concentrandosi in particolare sulle erbe dedicate a san Giovanni. Si propongono percorsi motivazionali anche alla luce di ipotesi etimologiche inedite.

Dialettologia siciliana botanica agiofitonimi etimologia motivazionale iconimia
researchProduct

Typification of 14 names in the Dianthus virgineus group (Caryophyllaceae)

2021

The nomenclature of 14 taxa from Central and Southern Europe within the Dianthus virgineus group is discussed. Dianthus aggericola Jord., D. collivagus Jord., D. consimilis Jord., D. orophilus Jord., D. saxicola Jord., D. juratensis Jord. are here lectotypified by specimens from the Jordan herbarium in LY, while D. godronianus Jord. by a specimen in P. Dianthus subacaulis Vill. is neotypified by a specimen collected on Mont Ventoux (S. France) and housed in MPU. For D. sylvestris Wulfen, a lectotype is here designated and its previous neotypification is discussed. Dianthus caryophyllus var. tenuifolius Moris, D. caryophyllus f. minor Moris and D. sylvestris var. garganicus Ten. are lectotyp…

Dianthus France Italy Slovenia NomenclatureSettore BIO/02 - Botanica SistematicaSouthern Europe and MediterraneanSloveniaBotanyCaryophyllaceaePlant ScienceSpecies InventoriesBiotaCaryophyllalesEuropeTracheophytaMagnoliopsidaItalyDianthusQK1-989nomenclatureFrancePlantaeDianthus humilisEcology Evolution Behavior and SystematicsDianthus; France; Italy; Slovenia; nomenclatureResearch ArticlePhytoKeys
researchProduct

La Dieta mediterranea per tutto l'anno

2016

La promozione e la valorizzazione della Dieta Mediterranea come strumento di prevenzione primaria delle principali malattie cardiovascolari, metaboliche, oncologiche e degenerative è l’obiettivo di Idimed e questo opuscolo è uno degli strumenti della sua strategia di divulgazione. Idimed, fedele alla sua impostazione sistemica, ha sempre parlato di alimentazione a 360°, integrando i diversi aspetti del fenomeno: culturali, salutistici, agronomici, botanici, gastronomici, psicologici, relazionali e della comunicazione. Far conoscere l’alimento, descrivere la realizzazione della ricetta, fornire indicazioni su quantità, uso dei condimenti, specificità della tradizione e raccomandazioni saluti…

Dieta Mediterranea Menu StagionaliSettore BIO/02 - Botanica Sistematica
researchProduct

IL DINAMISMO DELLA VEGETAZIONE IN UNA MONTAGNA RAPPRESENTATIVA DELLA SICILIA: LE MADONIE

2013

RÉSUMÉ On décrit les séries de végétation du massif des Madonie en Sicile. Ici sont développées trois séries dynamiques de végétation, à savoir: la série mesophyle basiphyle du hêtre (Fagus sylvatica) , la série océanique acidophyle méridionale du hêtre (Fagus sylvatica) et la série orophyle acidophyle du rouvre méridionale (Quercus petraea subsp. austrotyrrhenica).

Dinamismo Vegetazione MadonieSettore BIO/03 - Botanica Ambientale E Applicata
researchProduct