Search results for "FFL"

showing 10 items of 546 documents

Coincident glutamatergic depolarizations enhance GABAA receptor-dependent Cl- influx in mature and suppress Cl- efflux in immature neurons.

2021

The impact of GABAergic transmission on neuronal excitability depends on the Cl--gradient across membranes. However, the Cl--fluxes through GABAA receptors alter the intracellular Cl- concentration ([Cl-]i) and in turn attenuate GABAergic responses, a process termed ionic plasticity. Recently it has been shown that coincident glutamatergic inputs significantly affect ionic plasticity. Yet how the [Cl-]i changes depend on the properties of glutamatergic inputs and their spatiotemporal relation to GABAergic stimuli is unknown. To investigate this issue, we used compartmental biophysical models of Cl- dynamics simulating either a simple ball-and-stick topology or a reconstructed CA3 neuron. Th…

Databases FactualPhysiologyNervous SystemBiochemistrySynaptic TransmissionAnimal CellsMedicine and Health SciencesCl effluxBiology (General)Receptorgamma-Aminobutyric AcidNeuronsNeuronal PlasticityEcologyNeuronal MorphologyGABAA receptorChemistryPyramidal CellsNeurochemistryNeurotransmittersCA3 Region HippocampalElectrophysiologymedicine.anatomical_structureComputational Theory and MathematicsModeling and SimulationGABAergicAnatomyCellular TypesReceptor PhysiologyIntracellularResearch ArticleCell PhysiologyQH301-705.5Models NeurologicalNeurophysiologyMembrane PotentialCellular and Molecular NeuroscienceGlutamatergicChloridesGeneticsmedicineAnimalsMolecular BiologyEcology Evolution Behavior and SystematicsBiology and Life SciencesComputational BiologyCell BiologyNeuronal DendritesReceptors GABA-ACellular NeuroscienceSynapsesCa3 pyramidal neuronDepolarizationNeuronNeuroscienceNeurosciencePLoS Computational Biology
researchProduct

An advanced control strategy for biological nutrient removal in continuous systems based on pH and ORP sensors

2012

[EN] A fuzzy logic-based control system that uses low-cost sensors for controlling and optimizing the biological nitrogen removal in continuous systems has been developed. The novelty of this control system is the use of several pH, ORP, and dissolved oxygen (DO) sensors instead of on-line nitrogen sensors/analyzers. The nitrogen control system was developed and implemented in a UCT pilot plant fed with wastewater from a full-scale plant. The developed nitrification controller allows the effluent ammonium concentration to be maintained below the effluent criteria discharge with the minimum energy consumption. The denitrification process controller allows the energy consumption derived from …

DenitrificationChemistryGeneral Chemical EngineeringEnvironmental engineeringGeneral ChemistryEnergy consumptionNitrificationIndustrial and Manufacturing EngineeringFuzzy logicPilot plantWastewaterControl theoryControl systemControlDenitrificationEnvironmental ChemistryNitrificationBiological nitrogen removalLow-cost sensorsEffluentTECNOLOGIA DEL MEDIO AMBIENTE
researchProduct

Enhanced nitrogen removal of low carbon wastewater in denitrification bioreactors by utilizing industrial waste toward circular economy

2020

Abstract Aquaculture needs practical solutions for nutrient removal to achieve sustainable fish production. Passive denitrifying bioreactors may provide an ecological, low-cost and low-maintenance approach for wastewater nitrogen removal. However, innovative organic materials are needed to enhance nitrate removal from the low carbon effluents in intensive recirculating aquaculture systems (RAS). In this study, we tested three additional carbon sources, including biochar, dried Sphagnum sp. moss and industrial potato residues, to enhance the performance of woodchip bioreactors treating the low carbon RAS wastewater. We assessed nitrate (NO3−) removal and microbial community composition durin…

DenitrificationRenewable Energy Sustainability and the Environment020209 energyStrategy and Management05 social sciencesRecirculating aquaculture system02 engineering and technologyBuilding and ConstructionPulp and paper industryIndustrial and Manufacturing EngineeringIndustrial wasteDenitrifying bacteriaWastewaterBiochar050501 criminology0202 electrical engineering electronic engineering information engineeringBioreactorEnvironmental scienceEffluent0505 lawGeneral Environmental ScienceJournal of Cleaner Production
researchProduct

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Chromium speciation using activated alumina microcolumns and sequential injection analysis-flame atomic absorption spectrometry

2001

Abstract A new procedure has been developed for chromium speciation in water by sequential injection analysis and flame atomic absorption spectrometry. The method involves the online retention of Cr(VI) anionic species and Cr(III) cationic species on alumina microcolumns, prepared by packing activated alumina in polytetrafluoroethylene tubes, followed by selective elution of Cr(VI) with 2 mol l −1 NH 4 OH and of Cr(III) with 0.2 mol l −1 HNO 3 . Studies were carried out on the effect of retention and elution conditions for both Cr species. The limit of detection values, established as the concentration corresponding to three times the standard deviation of blank measurements divided by the …

Detection limitChromatographyElutionCationic polymerizationActivated aluminachemistry.chemical_elementAnalytical Chemistrylaw.inventionChromiumchemistrylawAtomic absorption spectroscopyEffluentSludgeTalanta
researchProduct

A clean method for flow injection spectrophotometric determination of cyclamate in table sweeteners

2005

Abstract A flow system based on the multicommutation is proposed for fast and clean determination of cyclamate. The procedure exploits the reaction of cyclamate with nitrite in acidic medium and the spectrophotometric determination of the excess of nitrite by iodometry. The flow system was designed with a set of solenoid micro-pumps to minimize reagent consumption and waste generation. The detection limit was estimated as 30 μmol L −1 (99.7% confidence level) with linear response ranging up to 3.0 mmol L −1 . The coefficient of variation was estimated as 1.7% for a solution containing 2.0 mmol L −1 cyclamate ( n  = 20). About 60 samples can be analyzed per hour, consuming only 3 mg KI and 1…

Detection limitChromatographymedicine.diagnostic_testChemistryCoefficient of variationBiochemistryAnalytical ChemistryWaste generationchemistry.chemical_compoundIodometrySpectrophotometryReagentmedicineEnvironmental ChemistryNitriteEffluentSpectroscopyAnalytica Chimica Acta
researchProduct

Zinc removal in anaerobic sulphate-reducing liquid substrate process

2002

Abstract Zinc and sulphate removal from synthetic wastewater was investigated by using four laboratory parallel upflow-mode reactors (referred as R1 to R4; R1 contained carriers to retain biomass, whereas R2–R4 were operated as suspended reactors). All reactors were inoculated with anaerobically digested cow manure. R1 and R2 were first fed with glucose- and sulphate-containing feed for 48 days after which all four reactors were fed with wastewater containing 50 mg l−1 of zinc in R1–R3 and 200 mg l−1 in R4 and operated for 96 days. In all reactors, hydraulic retention time, organic loading rate, and sulphate load were 5–6 d, 0.2–0.4 kg COD m−3 d−1 and 3.3–3.8 g SO4 l−1 d−1, respectively, wh…

Detection limitWaste managementHydraulic retention timeMechanical Engineeringchemistry.chemical_elementSubstrate (chemistry)General ChemistryZincGeotechnical Engineering and Engineering GeologyPulp and paper industrychemistry.chemical_compoundWastewaterchemistryControl and Systems EngineeringSulfateEffluentCow dungMinerals Engineering
researchProduct

On the Shuffle of Star-Free Languages

2012

Motivated by the general problem to characterize families of languages closed under shuffle, we investigate some conditions under which the shuffle of two star-free languages is star-free. Some of the special cases here approached give rise to new problems in combinatorics on words.

Discrete mathematicsAlgebra and Number TheorySettore INF/01 - Informaticapure submonoidGeneral problemAbstract family of languagesRegular languageComputer Science::Computation and Language (Computational Linguistics and Natural Language and Speech Processing)Star (graph theory)star-free languageCone (formal languages)shuffle of languagePumping lemma for regular languagesTheoretical Computer ScienceCombinatorics on wordsComputational Theory and MathematicsRegular languagecombinatorics on words.Information SystemsMathematicsFundamenta Informaticae
researchProduct

A loopless algorithm for generating the permutations of a multiset

2003

AbstractMany combinatorial structures can be constructed from simpler components. For example, a permutation can be constructed from cycles, or a Motzkin word from a Dyck word and a combination. In this paper we present a constructor for combinatorial structures, called shuffle on trajectories (defined previously in a non-combinatorial context), and we show how this constructor enables us to obtain a new loopless generating algorithm for multiset permutations from similar results for simpler objects.

Discrete mathematicsMultisetMathematics::CombinatoricsGeneral Computer ScienceMultiset permutationsLoopless algorithmStructure (category theory)Context (language use)Gray codesTheoretical Computer ScienceCombinatoricsGray codePermutationLoopless generating algorithmsShuffle combinatorial objectsBinomial coefficientWord (computer architecture)Computer Science::Formal Languages and Automata TheoryMathematicsMathematicsofComputing_DISCRETEMATHEMATICSComputer Science(all)Theoretical Computer Science
researchProduct

Widening the applicability of AnMBR for urban wastewater treatment through PDMS membranes for dissolved methane capture: Effect of temperature and hy…

2021

[EN] AnMBR technology is a promising alternative to achieve future energy-efficiency and environmental-friendly urban wastewater (UWW) treatment. However, the large amount of dissolved methane lost in the effluent represents a potential high environmental impact that hinder the feasibility of this technology for full-scale applications. The use of degassing membranes (DM) to capture the dissolved methane from AnMBR effluents can be considered as an interesting alternative to solve this problem although further research is required to assess the suitability of this emerging technology. The aim of this study was to assess the effect of operating temperature and hydrodynamics on the capture of…

Dissolved methane captureEnvironmental EngineeringGreenhouse gas (GHG) emissions0208 environmental biotechnology02 engineering and technology010501 environmental sciencesManagement Monitoring Policy and LawWastewater01 natural sciencesWaste Disposal FluidMethaneWater Purificationchemistry.chemical_compoundBioreactorsOperating temperatureMass transferAnaerobiosisDimethylpolysiloxanesWaste Management and DisposalEffluentTECNOLOGIA DEL MEDIO AMBIENTE0105 earth and related environmental sciencesPDMS degassing MembraneEnergy recoveryFoulingAnaerobic membrane bioreactor (AnMBR)Membrane foulingUrban wastewaterTemperatureMembranes ArtificialGeneral MedicinePulp and paper industry020801 environmental engineeringWastewaterchemistryHydrodynamicsEnvironmental scienceMethaneJournal of environmental management
researchProduct