Search results for "Tale"

showing 10 items of 6428 documents

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Energy performance improvements of a DEC system due to wet heat exchangers

2011

This work concerns an innovative desiccant and evaporative cooling (DEC) system for building air conditioning. The original system is an experimental DEC air handling unit installed at the Solar Laboratory of the University of Palermo and recently modified and updated. With the aim to increase the cooling effect due to water evaporation in the return air flow rate, the sensible heat exchanger was replaced with two cross flow flat plate heat exchangers installed in series, with continuous humidification of the secondary air flow. The new thermodynamic cycle is theoretically described and the realization of the real application is shown. Detailed operational data and energy performance indica…

Desiccant Evaporative CoolingSettore ING-IND/11 - Fisica Tecnica AmbientaleDEC-Air Handling Unit air to air packaged wet heat exchanger thermal COP electrical COP
researchProduct

Odesse: A New Tool for Simulation and Design of Solar Desiccant Cooling Systems in Energy Efficient Buildings

2010

DesiccantEngineeringArchitectural engineeringSettore ING-IND/11 - Fisica Tecnica Ambientalebusiness.industrysolar desiccant cooling computer simulationProcess engineeringbusinessEfficient energy useProceedings of the EuroSun 2010 Conference
researchProduct

Simplified models for the performance evaluation of desiccant wheel dehumidification

2002

In the present communication, simple models have been presented to evaluate the performance of rotary desiccant wheels based on different kind of solid desiccants e.g. silica gel and LiCl. The first part of the paper presents ‘Model 54’ which is developed for silica gel desiccant rotor. The model has been derived from the interpolation of experimental data obtained from the industry and the correlations have been developed for predicting outlet temperature and absolute humidity. The ‘Model 54’ consists of 54 coefficients corresponding to each correlation for outlet absolute humidity and temperature and it is found that the model predicts very well the performance of silica gel desiccant rot…

DesiccantEngineeringSettore ING-IND/11 - Fisica Tecnica AmbientaleRenewable Energy Sustainability and the Environmentbusiness.industrySilica gelRotor (electric)PsychrometricsEnergy Engineering and Power TechnologyMechanical engineeringHumiditylaw.inventionchemistry.chemical_compoundmodelsFuel TechnologyNuclear Energy and EngineeringchemistryAir conditioninglawPerformance predictionRelative humiditybusinessdesiccant cooling
researchProduct

Experimental results on adsorption beds for air dehumidification

2016

Desiccant rotors are commonly used in large scale solar cooling open cycle applications. As is well known, adsorption heat sensibly reduces the dehumidification capacity of the desiccant material and results in lower system performance. The aim of this work is to describe an innovative solution that permits simultaneous mass and heat transfer. In particular, two components working with silica gel fixed beds were studied and compared. The first component is a simple packed bed containing silica gel grains. The second component is a fin and tube heat exchanger commonly used in several air conditioning applications wherein the spaces between the fins are filled with silica gel grains. In this …

DesiccantMaterials science020209 energyThermodynamics02 engineering and technologychemistry.chemical_compoundAdsorptionSolar air conditioningPacked bedHeat exchanger0202 electrical engineering electronic engineering information engineeringComposite materialDECPacked bedAdsorption; DEC; Dehumidification; Packed bed; Silica gel; Solar cooling; Mechanical Engineering; Building and ConstructionSolar coolingSettore ING-IND/11 - Fisica Tecnica AmbientaleSilica gelbusiness.industryMechanical EngineeringSilica gelBuilding and Construction021001 nanoscience & nanotechnologychemistryAir conditioningHeat transferAdsorptionDehumidification0210 nano-technologybusiness
researchProduct

Monitoring Results and Energy Performances Evaluation of Freescoo Solar DEC Systems

2016

Abstract This work addresses the energy saving performances of some solar Desiccant and Evaporative Cooling (DEC) systems working with the freescoo technology. The innovative freescoo concept is based on the use two fixed and cooled adsorption beds and advanced indirect evaporative cooling processes. The main feature of this new adsorption bed concept is to allow the simultaneous dehumidification and cooling of air. The systems analyzed have been installed in Italy last here and results based on field monitoring data are here presented. A description of the monitored systems and comparisons between the energy performances based on the main performance indicators such as EER, thermal COP, co…

DesiccantPVTEngineeringWork (thermodynamics)Settore ING-IND/11 - Fisica Tecnica Ambientalebusiness.industry020209 energyfreescoo Solar DEC Adsorption fixed and cooled bed PVTfreescooAdsorption fixed and cooled bed02 engineering and technologyGridEnergy(all)freescoo; Solar DEC; Adsorption fixed and cooled bed; PVT ;Thermal0202 electrical engineering electronic engineering information engineeringSolar DECPerformance indicatorElectricitybusinessProcess engineeringPVT ;SimulationEnergy (signal processing)Evaporative coolerEnergy Procedia
researchProduct

Life Cycle Assessment of a compact Desiccant Evaporative Cooling system: The case study of the “Freescoo”

2016

Abstract The paper aims at exploring the performances of a compact Desiccant Evaporative Cooling system called “Freescoo” (Free Solar Cooling) in comparison to standard conventional technologies. The Freescoo – that aims at applications in the residential sector and in small office buildings and includes a photovoltaic–thermal system – is analyzed, its monitored performance discussed and reported: under cooling conditions an Energy Efficiency Ratio of 12.8 is calculated, that reaches 50.7 if also photovoltaic generation is considered. To assess the performance of the proposed system a Life Cycle Assessment study was performed to investigate the system covering all its life, from the product…

DesiccantSettore ING-IND/11 - Fisica Tecnica AmbientaleRenewable Energy Sustainability and the Environmentbusiness.industry020209 energyPhotovoltaic system02 engineering and technologyLife Cycle AssessmentEnvironmentSolar energySeasonal energy efficiency ratioSurfaces Coatings and FilmsElectronic Optical and Magnetic MaterialsSolar air conditioningSolar energySustainabilityDEC system0202 electrical engineering electronic engineering information engineeringEnvironmental sciencebusinessProcess engineeringLife-cycle assessmentWater useEvaporative coolerSolar Energy Materials and Solar Cells
researchProduct

Second Generation of Freescoo Solar DEC Prototypes for Residential Applications

2015

Freescoo is an innovative all-in-one compact solar Desiccant Evaporative Cooling (DEC) air conditioner concept. Results of the first prototype developed were presented at SHC Conference last year. Now a second generation of freescoo prototypes for applications in residential and small office buildings have been installed in Italy at ENEA Casaccia and at UNIPA. The thermodynamic cycle is based on the use of fixed and cooled adsorption beds and advanced evaporative cooling concepts. The adsorption bed, which is a fin and tube heat exchanger packed with silica gel grains, allows simultaneous dehumidification and cooling of the process air. The indirect evaporative cooling process, operated dow…

Desiccantfreescoo compact Solar DEC Adsorption fixed and cooled bed stand-alone operationEngineeringSettore ING-IND/11 - Fisica Tecnica Ambientalebusiness.industryWet-bulb temperatureNuclear engineeringElectrical engineeringPlate heat exchangerstand-alone operationfreescooAdsorption fixed and cooled bedtand-alone operationstand-alone operation ;Energy(all)Air conditioningThermodynamic cycleThermalHeat exchangercompact Solar DECAdsorption fixed and cooled bed;freescoo;compact Solar DEC;stand-alone operationbusinessEvaporative coolerEnergy Procedia
researchProduct

From athletic talent development to dual career development? A case study in a Finnish high performance sports environment

2020

The focus of dual career (DC) research has shifted from exploring individual experiences within Athletic Talent Development Environments (ATDEs) toward understanding the impact of the environment and the broader cultural context on individuals’ developmental trajectories in Dual Career Development Environments (DCDEs). To comply with national and EU recommendations for socially responsible elite sport, many successful ATDEs list DC as one of their primary values and advertise themselves as DCDEs in order to attract more athletes. The present study aimed to evaluate whether and how a talent development environment for youth athletes in Finland has transformed from an ATDE to DCDE by explorin…

Development environmentkriittinen realismiSocial Psychologyorganisational culturedevelopment environmentOrganizational cultureCritical realism (philosophy of the social sciences)050105 experimental psychologyurheiluakatemiat03 medical and health sciencesurheilu-ura0302 clinical medicinenuoret0501 psychology and cognitive sciencesApplied Psychologyyouth athletesFocus (computing)ComputingMilieux_THECOMPUTINGPROFESSION05 social sciences030229 sport sciencesDUAL (cognitive architecture)Talent developmentorganisaatiokulttuuridual careeropiskelucritical realismEngineering ethicsPsychologyurheilijatCareer developmentInternational Journal of Sport and Exercise Psychology
researchProduct

The sludge dewaterability in advanced wastewater treatment: a survey of four different Membrane BioReactor pilot plants

2017

The wasted activated sludge dewaterability represents a major concern for Wastewater Treatment Plants (WWTPs) managers. Indeed, whereas the dewatered sludge could represents a re-usable matrix, the principal drawback related to the wasted sludge dewaterability is the high water content due to the presence of extracellular polymeric substances (EPS) that allow the trapping of water molecules within the bio sludge flocs. In order to provide an outlook of the dewaterability features of activated sludge derived from advanced WWTP, the present research reports a long term survey (over two years) aimed at assessing the principal dewaterability parameters of the sludge wasted from different Membra…

Dewatered sludgeSludge DewaterabilitySettore ICAR/03 - Ingegneria Sanitaria-AmbientaleHigh water contentMembrane bioreactorPulp and paper industryMBRExtracellular polymeric substanceActivated sludgeEnvironmental scienceSewage treatmentSludge dewaterability SRF CSTSRFEPSCST
researchProduct