Search results for "desert"

Manna Springing from the Earth

2012

At one of my aunt’s, there was an illustrated children’s edition of the Bible. I was six or seven years old, and on Saturday afternoons she would often take care of me. It was a fortunate deal everybody gained from. My parents were free to do the shopping and get some fresh air. My aunt enjoyed stuffing me with biscuits and milk, but not as much as I enjoyed the adventures of the Bible lands: Yahweh furiously unleashing plagues on the Pharaoh, the miraculous escape from Egypt, with the Red Sea saving the tribes, in extremis, from Ramses’ troops; the great king on his knees, watching the bodies of his drowned soldiers, wondering why God might favor a bunch of goat keepers; Moses wandering th…

“Let None Desert the Church on My Account”Some Inconsistencies Regarding the Chrysostomic Vision on the Unity of the Church

2019

Abstract By comparing St. John Chrysostom’s statements on Church unity after his dismissal, one can notice serious inconsistencies between the texts written by John himself and the statements attributed to him by Palladius of Helenopolis, who attempted to attenuate the outcome of the Johannite schism. In fact, the discrepancies are considerable and the Chrysostomic epistles addressed to the oriental bishops (85-90) imply that St. John encouraged the schism.

Comment and Reply on “Mapping of serpentinites in the Eastern Desert of Egypt by using Landsat thematic mapper data”

1987

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Caratterizzazione dei processi di siccità e di desertificazione su scala regionale

2009

Xeric grasslands of the inner-alpine dry valleys of Austria - new insights into syntaxonomy, diversity and ecology

2021

We are grateful to the IAVS for financial support for some of the participants. We would like to give special thanks to Dr. Ernst Partl, director of the Naturpark Kaunergrat for authorizing sampling in the protected areas and for helping with the organization of the field workshop.

Evidence for a biogenic, microorganismal origin of rock varnish from the Gangdese Belt of Tibet

2010

In the present study we examined material from the Ashikule Basin of Tibet. Chemical analyses were performed by use of energy dispersive X-ray spectroscopy and electron probe microanalysis to clarify whether the varnish layers that had developed on the surface of the rhyolite are indeed composed of varnish bodies and silica glaze. Electron microscopic analyses revealed that the surface of the varnish is covered both by filamentous hyphae bacterial and cocci-shaped forms. Within the varnish mineral layer in those samples two forms of bacteria-like microorganisms exist; cocci as tightly packed bacterial aggregates [within varnish bodies], and bacillus-like microorganisms [within the varnish m…

The potential of multilayer green roofs for stormwater management in urban area under semi-arid Mediterranean climate conditions

2022

Different low impact development measures have been proposed to make cities more flood-resilient, and recent literature is paying great attention to the evaluation of their direct benefits in terms of flood risk mitigation and the numerous co-benefits that they may offer. This study describes an experimental prototype of a technologically advanced multilayer green roof installed in a Mediterranean urban area (i.e., Palermo, Italy) and explores the results of an analysis of data collected over a one-year monitoring period by a complex sensors network. Multilayer green roofs, or "blue-green" roofs (BGRs), are characterized by a high water retention capacity compared to traditional green roofs…

Islands of biogeodiversity in arid lands on a polygons map study: Detecting scale invariance patterns from natural resources maps.

2016

Many maps (geology, hydrology, soil, vegetation, etc.) are created to inventory natural resources. Each of these resources is mapped using a unique set of criteria, including scales and taxonomies. Past research indicates that comparing results of related maps (e.g., soil and geology maps) may aid in identifying mapping deficiencies. Therefore, this study was undertaken in Almeria Province, Spain to (i) compare the underlying map structures of soil and vegetation maps and (ii) investigate if a vegetation map can provide useful soil information that was not shown on a soil map. Soil and vegetation maps were imported into ArcGIS 10.1 for spatial analysis, and results then exported to Microsof…

Characterization and differentiation of rock varnish types from different environments by microanalytical techniques

2017

© 2017 Elsevier B.V. We investigated rock varnishes collected from several locations and environments worldwide by a broad range of microanalytical techniques. These techniques were selected to address the challenges posed by the chemical and structural complexity within the micrometer- to nanometer-sized structures in these geological materials. Femtosecond laser ablation-inductively coupled plasma-mass spectrometry (fs LA-ICP-MS), scanning transmission X-ray microscopy-near edge X-ray adsorption fine structure spectroscopy (STXM-NEXAFS) in combination with scanning electron microscopy (SEM) of focused ion beam (FIB) ultra-thin (100–200 nm) sections, conventional and polarization microscop…