Search results for "sistematica"

showing 10 items of 815 documents

First record of Tamarix meyeri (Tamaricaceae) for western Europe

2012

Abstract Field investigations and herbaria reference work carried out in Italy and Spain allowed us to identify wild and cultivated plants of Tamarix meyeri, a new species from western Europe. This small tree is characterized by tetramerous, rarely pentamerous flowers and a paralophic disk.

Cultivated plant taxonomybiologyEcologySettore BIO/02 - Botanica SistematicaTamarixPlant Sciencebiology.organism_classificationHerbariumGeographyWestern europeBotanyDistribution Ecology Herbaria Tamarix meyeri Tamaricaceae western EuropeTamaricaceaeEcology Evolution Behavior and Systematics
researchProduct

Efficacia delle AMP nella conservazione della biodiversità: i popolamenti a Cystoseira nell’AMP “Capo Gallo-Isola delle Femmine” (Pa)

2008

Scopo dello studio è quello di i) valutare lo stato di salute e di conservazione delle comunità a Cystoseira presenti nell’A.M.P. “Capo Gallo-Isola delle Femmine” ii) confrontarlo con i dati storici, iii) confrontarlo con quello di siti di controllo al di fuori dell’A.M.P. e quindi iv) verificare il successo/efficacia dell’A.M.P nel proteggere e mantenere queste comunità e quindi la biodiversità di questi ecosistemi dalla sempre più intensa pressione antropica. Lo studio viene condotto, in particolare, sui popolamenti a Cystoseira dell’infralitorale di siti chiave all’interno della Riserva (Zone A, B e C) e di due siti di controllo: Punta Priola (PA) e Monte Cofano (TP). Lo stato di conserv…

Cystoseira Aree marine Protette conservazione Mar MediterraneoSettore BIO/02 - Botanica Sistematica
researchProduct

Phytochemical Constituents, Antioxidant Activity, and Toxicity Assessment of the Aerial Part Extracts from the Infraspecific Taxa of Matthiola frutic…

2021

In a project designed to investigate the specific and infraspecific taxa of Matthiola endemic to Sicily (Italy) as new potential sources of bioactive compounds in this work, the infraspecific taxa of Matthiola fruticulosa were studied, namely, subsp. fruticulosa and subsp. coronopifolia. HPLC–PDA/ESI–MS and SPME–GC/MS analyses of hydroalcoholic extracts obtained from the aerial parts of the two subspecies led to the detection of 51 phenolics and 61 volatile components, highlighting a quite different qualitative–quantitative profile. The antioxidant properties of the extracts were explored through in vitro methods: 1,1-diphenyl-2-picrylhydrazyl (DPPH), reducing power and Fe2+ chelating activ…

DPPHPharmaceutical Sciencebiological activityBrine shrimpMatthiolaSubspecies01 natural sciencesAnalytical Chemistry03 medical and health scienceschemistry.chemical_compoundQD241-441Biological activity; Chemical composition; Matthiola fruticulosa; Native plants; Natural resource; Sicily; Animals; Antioxidants; Artemia; Brassicaceae; Larva; Phytochemicals; Plant Extracts; Sicily; Toxicity Tests.Drug Discoverychemical compositionBioassaySettore BIO/15 - Biologia FarmaceuticaPhysical and Theoretical ChemistrySicily030304 developmental biology0303 health sciencesbiologyTraditional medicineSettore BIO/02 - Botanica Sistematica<i>Matthiola fruticulosa</i>Organic ChemistryBrassicaceaenative plantsnative plantbiology.organism_classificationnatural resource0104 chemical sciences010404 medicinal & biomolecular chemistrychemistryPhytochemicalChemistry (miscellaneous)Matthiola fruticulosaMolecular MedicineArtemia salinaMolecules
researchProduct

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Typification of 14 names in the Dianthus virgineus group (Caryophyllaceae)

2021

The nomenclature of 14 taxa from Central and Southern Europe within the Dianthus virgineus group is discussed. Dianthus aggericola Jord., D. collivagus Jord., D. consimilis Jord., D. orophilus Jord., D. saxicola Jord., D. juratensis Jord. are here lectotypified by specimens from the Jordan herbarium in LY, while D. godronianus Jord. by a specimen in P. Dianthus subacaulis Vill. is neotypified by a specimen collected on Mont Ventoux (S. France) and housed in MPU. For D. sylvestris Wulfen, a lectotype is here designated and its previous neotypification is discussed. Dianthus caryophyllus var. tenuifolius Moris, D. caryophyllus f. minor Moris and D. sylvestris var. garganicus Ten. are lectotyp…

Dianthus France Italy Slovenia NomenclatureSettore BIO/02 - Botanica SistematicaSouthern Europe and MediterraneanSloveniaBotanyCaryophyllaceaePlant ScienceSpecies InventoriesBiotaCaryophyllalesEuropeTracheophytaMagnoliopsidaItalyDianthusQK1-989nomenclatureFrancePlantaeDianthus humilisEcology Evolution Behavior and SystematicsDianthus; France; Italy; Slovenia; nomenclatureResearch ArticlePhytoKeys
researchProduct

Primo contributo alla filogenesi dei diaptomidi paleartico-occidentali (Copepoda, Calanoida)

2013

Diaptomidae filogenesi sistematica molecolareSettore BIO/05 - Zoologia
researchProduct

La Dieta mediterranea per tutto l'anno

2016

La promozione e la valorizzazione della Dieta Mediterranea come strumento di prevenzione primaria delle principali malattie cardiovascolari, metaboliche, oncologiche e degenerative è l’obiettivo di Idimed e questo opuscolo è uno degli strumenti della sua strategia di divulgazione. Idimed, fedele alla sua impostazione sistemica, ha sempre parlato di alimentazione a 360°, integrando i diversi aspetti del fenomeno: culturali, salutistici, agronomici, botanici, gastronomici, psicologici, relazionali e della comunicazione. Far conoscere l’alimento, descrivere la realizzazione della ricetta, fornire indicazioni su quantità, uso dei condimenti, specificità della tradizione e raccomandazioni saluti…

Dieta Mediterranea Menu StagionaliSettore BIO/02 - Botanica Sistematica
researchProduct

Diversity of Draba L. sect. Aizopsis DC. (Brassicaceae) in Sicily

2008

Draba Brassicaceae Sicily taxonomy biosystematics biodiversitySettore BIO/02 - Botanica Sistematica
researchProduct

Karyological data of four geophytes native to Tunisia

2021

Chromosome numbers were studied in four geophytes collected in Tunisia. Allium pallens was collected from Zembra island, N of Tunisia, while Drimia purpurascens, Oncostema peruvianum and Pancratium foetidum from continental Tunisia. The chromosome numbers found for Allium pallens, Drimia purpurascens, and Oncostema peruvianum coincides with the previous reports obtained from other Mediterranean populations. The chromosome number 2n = 22, found on material from Toujane is the first reported for Pancratium foetidum.

Drimia purpurascenOncostema peruvianumSettore BIO/02 - Botanica SistematicaAllium pallenPancratium foetidumPlant ScienceNorth AfricaChromosome number
researchProduct

Taxonomic investigation on Allium hirtovaginum group (Amaryllidaceae) from East Mediterranean area

2021

Within taxonomic studies on Allium sect. Codonoprasum from Mediterranean flora, populations belonging to A. hirtovaginum Candargy group were examined. Based on field investigation and herbarium surveyes, this group is represented by very critical and not well known taxa, distributed in the East Mediterranean, showing a marked morphological variability. Currently, the species referable to this group in addition to A. hirtovaginum are also A. pilosum Sibth. &amp; Sm., A. aeginiense Brullo, Giusso &amp; Terrasi and A. nerimaniae Koçyiğit &amp; Kaya. Besides, other 13 species are here described as new to science, they are A. pythagoricum, A. pignattii, A. hippocraticum, A. abanticum, A. velutin…

East MediterraneanAllium hirtovaginumBiogeographySect. CodonoprasumSettore BIO/02 - Botanica SistematicaKaryologyTaxonomy
researchProduct