0000000001179335
AUTHOR
M Davino
Inula viscosa L. a new host of Cucumber mosaic virus
Morphological and molecular characterization of distinct species of fungi with potential medicinal interest collected in Sicily
Medicinal mushrooms are very interesting for their pharmacological effects as well as for their nutritional value, antitumor, antiviral, antibacterial activities. Antitumor activities of mushrooms have been extensively investigated due to recent chemotherapeutic application of some drugs derived from natural sources.The aim of this study was the morphological and molecular characterization of nine species of fungi with potential medicinal interest. In particular, we focused our attention on: Bjerkandera adusta (Willd) P. Karst., Ganoderma resinaceum Boud.,Hericium erinaceus (Bull.) Pers., Pleurotus eryngii var elaeoselini Venturella, Zervakis and La Rocca, P. eryngii var. eryngii (DC.) Quél…
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Actas de Horticultura
El cultivo de los cítricos comenzó en Extremo Oriente hace unos 4.000 años, en las regiones que ocupan actualmente China y Japón. Los grandes movimientos migratorios que ocasionaron las conquistas de Alejandro Magno, la expansión del Islam y el descubrimiento de América favorecieron la expansión de este cultivo por todo el mundo. Sin embargo, fue a partir del siglo XVIII cuando la citricultura adquirió una relevancia económica, tanto desde el punto de vista industrial como ornamental. El movimiento de plantas fue acompañado por la difusión de diversos patógenos, aunque afortunadamente, sólo una parte de los presentes en las regiones de origen han llegado en las nuevas áreas de cultivo. En I…
Complete sequence, genotyping and comparative analysis of Pepino mosaic virus discovered isolates from Italy
Pepino mosaic virus (PepMV) causes economic damage to the tomato industry worldwide. In Italy, the virus is endemic in Sicily, an important tomato-production region, and a new outbreak has been recorded in Sardinia after the first PepMV appearance in 2001. Italian PepMV isolates from these two geographically distant regions were molecularly characterized and the complete nucleotide sequence of four isolates was determined by walking primer strategy. The complete nucleotide and deduced amino acid sequences were analyzed and compared with published PepMV sequences. Italian isolates belong to the PepMV-Ch2 strain and had 97.2% to 98.5% identity with those of the reference PepMV-Ch2 deposited i…