0000000001192254
AUTHOR
A Bawadekji
First Report of Agaricus aridicola in Saudi Arabia and Ecological Notes on Agaricus bisporus
Agaricus aridicola is reported for the first time from Saudi Arabia while Agaricus bisporus is a new record for Northern region of Saudi Arabia. This study includes notes on taxonomy, ecology and distribution of both the species. It was also reported that the habitat of A. aridicola and A. bisporus are characterized by calcareous sandy soil, poor in organic matter, with presence of little amount of salinity.
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
The OPTIMA (Organization for the Phyto‐Taxonomic Investigation of the Mediterranean Area) Commission on Fungi
A list of proposed activities/objectives by the members of OPTIMA Commission on Fungi is here reported: Prepare a list of local names related to wild edible mushrooms (WEM); Define a provisional catalogue of macrofungi that could be characterized as typical‐representatives of the Mediterranean region (MR); Publish a Checklist of all macrofungi occurring in the MR; Setup of a literature database on fungi occurring in the MR; Promote studies on Mediterranean fungi to be used as food and medicine, and examine their potential in other biotechnological applications (e.g. mushroom cultivation, treatment and detoxification of wastes etc.), incl. large‐scale (commercial) use; Document ethnomycologi…
A new record of the desert truffle Picoa lefebvrei in Saudi Arabia
A new record of Picoa lefebvrei from Saudi Arabia is reported accompanied by notes on its taxonomy, ecology, and distribution.
Local names for common wild edible mushrooms growing in Europe, North Africa and the Kingdom of Saudi Arabia
Mushroom hunters in rural areas call and identify wild edible mushrooms on the basis of their local or common names. Local names of mushrooms are also widely used in folk medicine and particularly in shamanic and religious rituals. Linking of local names with their respective scientific names is of fundamental importance for the exploitation of their market potential and for prevention of poisoning. We present a list of common names given to 45 wild edible mushroom taxa (28 basidiomycetes and 17 ascomycetes) occurring in Austria, the Czech Republic, France, Greece, Italy, the Kingdom of Saudi Arabia, Morocco, Romania, Serbia, and Spain. The selected taxa are Agaricus campestris., A. crocodi…