Search results for "Pathogen"
showing 10 items of 1657 documents
Development and validation of two PCR tests for the detection of and differentiation between Anaplasma ovis and Anaplasma marginale
2012
Anaplasma ovis and Anaplasma marginale are tick-transmitted bacteria that cause anaplasmosis in domestic and wild animals. Recent results show that some domestic and wild animals and ticks are susceptible to both A. ovis and A. marginale, thus supporting the need to differentiate between these species in hosts and ticks diagnosed with Anaplasma infection. However, although anaplasmosis is one of the most common diseases of grazing animals worldwide, rapid and effective tests are not available for the detection of and discrimination between these 2 Anaplasma species. The objective of this research was to develop an easy and reliable method to identify and discriminate between the closely rel…
Bacteria and free-living amoeba in the Lascaux Cave.
2008
3 pages, 1 table, 18 references. The collaboration of the Lascaux restoration team is highly appreciated. We thank Marisa Chelius for valuable comments on the manuscript.
Pseudomonas corrugata crpCDE is part of the cyclic lipopeptide corpeptin biosynthetic gene cluster and is involved in bacterial virulence in tomato a…
2014
Summary: Pseudomonas corrugataCFBP 5454 produces two kinds of cyclic lipopeptides (CLPs), cormycin A and corpeptins, both of which possess surfactant, antimicrobial and phytotoxic activities. In this study, we identified genes coding for a putative non-ribosomal peptide synthetase and an ABC-type transport system involved in corpeptin production. These genes belong to the same transcriptional unit, designated crpCDE. The genetic organization of this locus is highly similar to other PseudomonasCLP biosynthetic clusters. Matrix-assisted laser desorption ionization-time of flight-mass spectrometry (MALDI-TOF-MS) analysis revealed that transporter and synthetase genomic knock-out mutants were u…
The rise and the fall of a Pseudomonas aeruginosa endemic lineage in a hospital
2021
The biological features that allow a pathogen to survive in the hospital environment are mostly unknown. The extinction of bacterial epidemics in hospitals is mostly attributed to changes in medical practice, including infection control, but the role of bacterial adaptation has never been documented. We analysed a collection of Pseudomonas aeruginosa isolates belonging to the Besançon Epidemic Strain (BES), responsible for a 12year nosocomial outbreak, using a genotype-to-phenotype approach. Bayesian analysis estimated the emergence of the clone in the hospital 5 years before its opening, during the creation of its water distribution network made of copper. BES survived better than the refe…
Arbuscular mycorrhizal fungi influence host infection during epidemics in a wild plant pathosystem
2022
SummaryWhile pathogenic and mutualistic microbes are ubiquitous across ecosystems and often co-occur within hosts, how they interact to determine patterns of disease in genetically diverse wild populations is unknown.To test whether microbial mutualists provide protection against pathogens, and whether this varies among host genotypes, we conducted a field experiment in three naturally-occurring epidemics of a fungal pathogen, Podosphaera plantaginis, infecting a host plant, Plantago lanceolata, in the Åland Islands, Finland. In each population, we collected epidemiological data on experimental plants from six allopatric populations that had been inoculated with a mixture of mutualistic arb…
Genomic determinants of speciation and spread of the Mycobacterium tuberculosis complex
2019
14 páginas, 6 figuras
Aortic stenosis: insights on pathogenesis and clinical implications
2016
Aortic stenosis (AS) is a common valvular heart disease in the Western populations, with an estimated overall prevalence of 3% in adults over 75 years. To understand its patho-biological processes represents a priority. In elderly patients, AS usually involves trileaflet valves and is referred to as degenerative calcific processes. Scientific evidence suggests the involvement of an active "atherosclerosis-like" pathogenesis in the initiation phase of degenerative AS. To the contrary, the progression could be driven by different forces (such as mechanical stress, genetic factors and interaction between inflammation and calcification). The improved understanding presents potentially new thera…
Impact of a Three Amino Acid Deletion in the CH2 Domain of Murine IgG1 on Fc-Associated Effector Functions
2008
Abstract Four murine IgG subclasses display markedly different Fc-associated effector functions because of their differential binding to three activating IgG Fc receptors (FcγRI, FcγRIII, and FcγRIV) and C1q. Previous analysis of IgG subclass switch variants of 34-3C anti-RBC monoclonal autoantibodies revealed that the IgG1 subclass, which binds only to FcγRIII and fails to activate complement, displayed the poorest pathogenic potential. This could be related to the presence of a three amino acid deletion at positions 233–235 in the CH2 domain uniquely found in this subclass. To address this question, IgG1 insertion and IgG2b deletion mutants at positions 233–235 of 34-3C anti-RBC Abs were …
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Congenital secretory diarrhoea caused by activating germline mutations in GUCY2C
2016
Objective Congenital sodium diarrhoea (CSD) refers to a form of secretory diarrhoea with intrauterine onset and high faecal losses of sodium without congenital malformations. The molecular basis for CSD remains unknown. We clinically characterised a cohort of infants with CSD and set out to identify disease-causing mutations by genome-wide genetic testing. Design We performed whole-exome sequencing and chromosomal microarray analyses in 4 unrelated patients, followed by confirmatory Sanger sequencing of the likely disease-causing mutations in patients and in their family members, followed by functional studies. Results We identified novel de novo missense mutations in GUCY2C, the gene encod…