Search results for "Truffle"
showing 10 items of 16 documents
Wild and cultivated mushrooms as a model of sustainable development
2013
The natural resources are currently overexploited and since 1992 the Conference of Rio de Janeiro has focused on sustainable development to safeguard our planet for future generations. The Fungi kingdom includes producers of goods and services for ecosystems and organisms widely used in the food industry. Besides, macrofungi are recognized as nontimber forest products and could be utilized as agents of environmental management through weed biocontrol and environmental improvement. Moreover, the cultivation of fungi, in particular truffles, can provide an important income in agroecosystems, especially in marginal areas, along with the development of new technologies to produce novel products…
Truffle gathering and trade in the Monti Sicani Regional Park (Sicily, Italy), a new perspective for the local economy and for employment in economic…
2020
Italy is one of the most important countries in Europe for truffles gathering and trade. The socioeconomic potential of truffles has been recently investigated in Sicily, an unexplored region for hypogeous fungi until 1990. This paper provides an updated report on the distribution of truffles in a regional park, located in the inner part of Sicily. Topics covered include the methods of collection of Tuber aestivum and T. borchii, the periods of collection of truffles, the procedure for preservation before marketing and the percentage of truffle buyers in Sicily. Besides, a map of the investigated area integrating the presence of the truffle with all other ecological elements is provided. Th…
First identification of polymorphic microsatellite markers in the Burgundy truffle, Tuber aestivum (Tuberaceae)
2014
SPEIPMCT2Pour cette revue, la version de l'éditeur est autorisée mais il y a un embargo d'un an (mentionné dans les Conditions générales : "On Institutional Repositories after 12 months").On peut donc mettre la PJ en "publique" mais il faut indiquer une date d'embargo (un an à partir de la date de publication). L'embargo sera levé automatiquement. Laissée lors du dépôt en workflow par prudence.; Premise of the study: Tuber aestivum, the most common truffle in Europe, plays an important role in the commercial truffle market. For the first time, microsatellite primers were developed to investigate polymorphism within this species. • Methods and Results: Using direct shotgun pyrosequencing, 15…
Fine-scale spatial genetic structure analysis of the black truffle T uber aestivum and its link to aroma variability
2015
Truffles are symbiotic fungi in high demand by food connoisseurs. Improving yield and product quality requires a better understanding of truffle genetics and aroma biosynthesis. One aim here was to investigate the diversity and fine-scale spatial genetic structure of the Burgundy truffle Tuber aestivum. The second aim was to assess how genetic structuring along with fruiting body maturation and geographical origin influenced single constituents of truffle aroma. A total of 39 Burgundy truffles collected in two orchards were characterized in terms of aroma profile (SPME-GC/MS) and genotype (microsatellites). A moderate genetic differentiation was observed between the populations of the two o…
Microbial safety of black summer truffle collected from Sicily and Umbria Regions, Italy
2021
Background: Tuber aestivum Vittad., known as black summer truffle, represents high-value food especially used as garnishment in nouvelle cuisine. The aim of this study was to investigate on the viable microbial populations associated with T. aestivum ascomata collected in different sites of Sicily and one locality of Umbria (Italy).
 Methods: The ripe ascomata of black summer truffles were collected from Central Italy. Cell densities of spoilage bacteria, fecal indicators, potential pathogens, yeasts, and molds were analyzed. Statistical analysis was conducted with XLSTAT software.
 Results: The microbiological counts of truffles ranged between 6.00 and 9.63 log Colony Forming Uni…
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Macrofungi as ecosystem resources: Conservation versus exploitation
2013
Fungi are organisms of significant importance not only for the crucial roles they undertake in nature but also for many human activities that are strictly dependent on them. Indeed, fungi possess fundamental positions in ecosystems functioning including nutrient cycles and wood decomposition. As concerns human-related activities, edible and non-edible mushrooms are also involved and/or exploited in forestry, pharmaceutical industry and food production; hence, nowadays they represent a major economic source worldwide. In order to maintain and improve their strategic importance, several conservation strategies, such as habitat preservation, are needed. This article reports several contributio…
Antimicrobial Activity of the Desert Truffles "Tirmania pinoyi" and "Terfezia claveryi" Against Human Pathogens
2015
The development of novel antimicrobials in the struggle against pathogens and antibiotic resistance is one of the most important global challenges of our time. Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial and immune stimulating properties1. In recent years the traditional studies on epigeous higher Basidiomycetes have been joined by those on hypogeous fungi and in particular on the so-named “desert truffles”. Ali2 demonstrated that organic extraction of truffles of genus Tirmania and Terfezia possess antimicrobial activity with broad-spectrum effects against Gram positive, Gram negative, aerobic and anaerobic bacteria …
A new record of the desert truffle Picoa lefebvrei in Saudi Arabia
2012
A new record of Picoa lefebvrei from Saudi Arabia is reported accompanied by notes on its taxonomy, ecology, and distribution.
New distributive and ecological data on Tuber magnatum (Tuberaceae) in Italy
2014
The recent discovery of natural truffle grounds of the prized Tuber magnatum Pico in Sicily (southern Italy) allows to up-to-date the ecology and distribution of this choice edible mushroom in Italy and opens new economic opportunities in rural areas traditionally suffering from the economic point of view. The two new localities reported expand the southern range border of the species in Italy and Europe.