Search results for "Truffle"

showing 10 items of 16 documents

Wild and cultivated mushrooms as a model of sustainable development

2013

The natural resources are currently overexploited and since 1992 the Conference of Rio de Janeiro has focused on sustainable development to safeguard our planet for future generations. The Fungi kingdom includes producers of goods and services for ecosystems and organisms widely used in the food industry. Besides, macrofungi are recognized as nontimber forest products and could be utilized as agents of environmental management through weed biocontrol and environmental improvement. Moreover, the cultivation of fungi, in particular truffles, can provide an important income in agroecosystems, especially in marginal areas, along with the development of new technologies to produce novel products…

0106 biological sciencesAgroecosystemmushroom cultivationFood industryEmerging technologies[SDV]Life Sciences [q-bio]novel mushroom productsMELANOSPORUMDIVERSITYtruffleWeed biocontrol environmental management mushroom cultivation novel mushroom products trufflesPlant ScienceBiology010603 evolutionary biology01 natural sciencesenvironmental managementGoods and servicesANTIFUNGALANTIOXIDANTEcosystemEcology Evolution Behavior and Systematicsweed biocontrol; environmental management; mushroom cultivation; novel mushroom products; trufflesWeed biocontrol environmental management mushroom cultivation novel mushroom prducts trufflesBLACK TRUFFLE2. Zero hungerSustainable developmentAgroforestrybusiness.industryEcologyWeed biocontrolFUNGI15. Life on landNatural resourceTUBER-AESTIVUM VITTAD.SITU CONSERVATION13. Climate actionSettore BIO/03 - Botanica Ambientale E ApplicatatrufflesBIODIVERSITYCOMMUNITIESbusinessWeed010606 plant biology & botanyPlant Biosystems - An International Journal Dealing with all Aspects of Plant Biology
researchProduct

Truffle gathering and trade in the Monti Sicani Regional Park (Sicily, Italy), a new perspective for the local economy and for employment in economic…

2020

Italy is one of the most important countries in Europe for truffles gathering and trade. The socioeconomic potential of truffles has been recently investigated in Sicily, an unexplored region for hypogeous fungi until 1990. This paper provides an updated report on the distribution of truffles in a regional park, located in the inner part of Sicily. Topics covered include the methods of collection of Tuber aestivum and T. borchii, the periods of collection of truffles, the procedure for preservation before marketing and the percentage of truffle buyers in Sicily. Besides, a map of the investigated area integrating the presence of the truffle with all other ecological elements is provided. Th…

0106 biological sciencesTruffleTruffleproductive forestryPerspective (graphical)Plant Sciencedepressed arealocal economy010501 environmental sciences010603 evolutionary biology01 natural sciencesGeographyEconomyLocal economyparkSettore BIO/03 - Botanica Ambientale E ApplicataSicilyEcology Evolution Behavior and Systematics0105 earth and related environmental sciences
researchProduct

First identification of polymorphic microsatellite markers in the Burgundy truffle, Tuber aestivum (Tuberaceae)

2014

SPEIPMCT2Pour cette revue, la version de l'éditeur est autorisée mais il y a un embargo d'un an (mentionné dans les Conditions générales : "On Institutional Repositories after 12 months").On peut donc mettre la PJ en "publique" mais il faut indiquer une date d'embargo (un an à partir de la date de publication). L'embargo sera levé automatiquement. Laissée lors du dépôt en workflow par prudence.; Premise of the study: Tuber aestivum, the most common truffle in Europe, plays an important role in the commercial truffle market. For the first time, microsatellite primers were developed to investigate polymorphism within this species. • Methods and Results: Using direct shotgun pyrosequencing, 15…

0106 biological sciences[SDV]Life Sciences [q-bio]PopulationtrufflePlant ScienceBiology010603 evolutionary biology01 natural sciencespolymorphismLoss of heterozygosity03 medical and health sciencesTuberaceaeTuber aestivumTuber aestivumlcsh:BotanyTuber uncinatumPolymorphic Microsatellite Markereducationlcsh:QH301-705.5Ecology Evolution Behavior and Systematics030304 developmental biologyGenetics0303 health scienceseducation.field_of_studyTruffle[ SDV ] Life Sciences [q-bio]direct shotgun pyrosequencing;polymorphism;truffle;Tuber aestivum;TuberaceaeTuberaceaebiology.organism_classificationlcsh:QK1-989microsatellites markerspyrosequencinglcsh:Biology (General)PyrosequencingMicrosatellitedirect shotgun pyrosequencingTuber aestivum;Tuber uncinatum;microsatellites markers;pyrosequencing
researchProduct

Fine-scale spatial genetic structure analysis of the black truffle T uber aestivum and its link to aroma variability

2015

Truffles are symbiotic fungi in high demand by food connoisseurs. Improving yield and product quality requires a better understanding of truffle genetics and aroma biosynthesis. One aim here was to investigate the diversity and fine-scale spatial genetic structure of the Burgundy truffle Tuber aestivum. The second aim was to assess how genetic structuring along with fruiting body maturation and geographical origin influenced single constituents of truffle aroma. A total of 39 Burgundy truffles collected in two orchards were characterized in terms of aroma profile (SPME-GC/MS) and genotype (microsatellites). A moderate genetic differentiation was observed between the populations of the two o…

2. Zero hunger0106 biological sciences0303 health sciencesTrufflefood and beverages15. Life on landBiologybiology.organism_classification010603 evolutionary biology01 natural sciencesMicrobiology03 medical and health sciencesYield (wine)Tuber aestivumGenotypeGenetic structureBotanyMicrosatelliteOrchardEcology Evolution Behavior and SystematicsAroma030304 developmental biologyEnvironmental Microbiology
researchProduct

Microbial safety of black summer truffle collected from Sicily and Umbria Regions, Italy

2021

Background: Tuber aestivum Vittad., known as black summer truffle, represents high-value food especially used as garnishment in nouvelle cuisine. The aim of this study was to investigate on the viable microbial populations associated with T. aestivum ascomata collected in different sites of Sicily and one locality of Umbria (Italy).
 Methods: The ripe ascomata of black summer truffles were collected from Central Italy. Cell densities of spoilage bacteria, fecal indicators, potential pathogens, yeasts, and molds were analyzed. Statistical analysis was conducted with XLSTAT software.
 Results: The microbiological counts of truffles ranged between 6.00 and 9.63 log Colony Forming Uni…

Agaricales Fungi Colony Count Microbial Food Microbiology Food Safety ItalyMicrobial safetyTruffleFood Safetybiologylcsh:TP368-456business.industryColony CountFungibiology.organism_classificationFood safetyToxicologylcsh:Food processing and manufactureAgaricales Fungi Colony Count Microbial Food Microbiology Food Safety ItalyGeographyMicrobialItalySettore BIO/03 - Botanica Ambientale E ApplicataColony countFood MicrobiologyFood microbiologyAgaricalesbusinessAgaricalesFood Science
researchProduct

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Macrofungi as ecosystem resources: Conservation versus exploitation

2013

Fungi are organisms of significant importance not only for the crucial roles they undertake in nature but also for many human activities that are strictly dependent on them. Indeed, fungi possess fundamental positions in ecosystems functioning including nutrient cycles and wood decomposition. As concerns human-related activities, edible and non-edible mushrooms are also involved and/or exploited in forestry, pharmaceutical industry and food production; hence, nowadays they represent a major economic source worldwide. In order to maintain and improve their strategic importance, several conservation strategies, such as habitat preservation, are needed. This article reports several contributio…

Nutrient cyclemushroom; truffle; mycodiversity; wood-decay fungi; exploitationAgroforestrybusiness.industryEcologySettore BIO/02 - Botanica SistematicafungitrufflePlant ScienceBiologyMycodiversitywood-decay fungiHabitatGenetic resourcesMycodiversity wood-decay fungi mushroom truffle exploitationSettore BIO/03 - Botanica Ambientale E ApplicataFood processingmushroomEcosystembusinessEcology Evolution Behavior and Systematicsexploitation
researchProduct

Antimicrobial Activity of the Desert Truffles "Tirmania pinoyi" and "Terfezia claveryi" Against Human Pathogens

2015

The development of novel antimicrobials in the struggle against pathogens and antibiotic resistance is one of the most important global challenges of our time. Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial and immune stimulating properties1. In recent years the traditional studies on epigeous higher Basidiomycetes have been joined by those on hypogeous fungi and in particular on the so-named “desert truffles”. Ali2 demonstrated that organic extraction of truffles of genus Tirmania and Terfezia possess antimicrobial activity with broad-spectrum effects against Gram positive, Gram negative, aerobic and anaerobic bacteria …

Settore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore BIO/19 - Microbiologia GeneraleDesert Truffles Antimicrobial activity Human pathogens
researchProduct

A new record of the desert truffle Picoa lefebvrei in Saudi Arabia

2012

A new record of Picoa lefebvrei from Saudi Arabia is reported accompanied by notes on its taxonomy, ecology, and distribution.

Settore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E Applicatatruffle drip irrigation Arar
researchProduct

New distributive and ecological data on Tuber magnatum (Tuberaceae) in Italy

2014

The recent discovery of natural truffle grounds of the prized Tuber magnatum Pico in Sicily (southern Italy) allows to up-to-date the ecology and distribution of this choice edible mushroom in Italy and opens new economic opportunities in rural areas traditionally suffering from the economic point of view. The two new localities reported expand the southern range border of the species in Italy and Europe.

Settore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E Applicatawhite truffle ecology distribution exploitationPlant Science
researchProduct