Search results for "pathogen"

showing 10 items of 1657 documents

Development and validation of two PCR tests for the detection of and differentiation between Anaplasma ovis and Anaplasma marginale

2012

Anaplasma ovis and Anaplasma marginale are tick-transmitted bacteria that cause anaplasmosis in domestic and wild animals. Recent results show that some domestic and wild animals and ticks are susceptible to both A. ovis and A. marginale, thus supporting the need to differentiate between these species in hosts and ticks diagnosed with Anaplasma infection. However, although anaplasmosis is one of the most common diseases of grazing animals worldwide, rapid and effective tests are not available for the detection of and discrimination between these 2 Anaplasma species. The objective of this research was to develop an easy and reliable method to identify and discriminate between the closely rel…

DNA BacterialVeterinary MedicineAnaplasmosisAnaplasmaSequence analysisMolecular Sequence DataMicrobiologySensitivity and SpecificityBacterial geneticslaw.inventionMajor surface protein 4Bacterial Proteinslawparasitic diseasesAnaplasma Diagnostics major surface protein 4 Polymerase Chain ReactionmedicineAnimalsAnaplasmaPathogenOvisDiagnosticsPolymerase chain reactionDNA PrimersBacteriological TechniquesbiologyAnaplasma ovisAnaplasma ovisSequence Analysis DNAbiology.organism_classificationmedicine.diseaseVirologyPolymerase chain reactionAnaplasma marginaleInfectious DiseasesMolecular Diagnostic TechniquesInsect ScienceParasitologyAnaplasmosis
researchProduct

Bacteria and free-living amoeba in the Lascaux Cave.

2008

3 pages, 1 table, 18 references. The collaboration of the Lascaux restoration team is highly appreciated. We thank Marisa Chelius for valuable comments on the manuscript.

DNA BacterialeducationBenzalkonium chloridemedicine.disease_causeMicrobiologyConfined SpacesCaveFusarium solani species complexmedicineEnvironmental MicrobiologyAnimalsAir ConditioningProtozoaAmoebaMolecular Biology[SDV.MP] Life Sciences [q-bio]/Microbiology and ParasitologyFree living amoebaEcosystemgeographygeography.geographical_feature_categorybiologyBacteriaEcologyOutbreakfood and beveragesLascaux CavePathogenic bacteriaGeneral Medicinesocial sciencesDNA Protozoanbiology.organism_classificationmusculoskeletal systemhumanities[SDV.MP]Life Sciences [q-bio]/Microbiology and ParasitologyArchaeologyBiofilmsProtozoaPaintingsFrancePathogensBacteriaEnvironmental MonitoringResearch in microbiology
researchProduct

Pseudomonas corrugata crpCDE is part of the cyclic lipopeptide corpeptin biosynthetic gene cluster and is involved in bacterial virulence in tomato a…

2014

Summary: Pseudomonas corrugataCFBP 5454 produces two kinds of cyclic lipopeptides (CLPs), cormycin A and corpeptins, both of which possess surfactant, antimicrobial and phytotoxic activities. In this study, we identified genes coding for a putative non-ribosomal peptide synthetase and an ABC-type transport system involved in corpeptin production. These genes belong to the same transcriptional unit, designated crpCDE. The genetic organization of this locus is highly similar to other PseudomonasCLP biosynthetic clusters. Matrix-assisted laser desorption ionization-time of flight-mass spectrometry (MALDI-TOF-MS) analysis revealed that transporter and synthetase genomic knock-out mutants were u…

DNA BacteriallipodepsipeptidesABC transporters corpeptins Lux R transcriptional regulators non-ribosomal peptide synthetase Pseudomonas.chromobacterium-violaceumcloningPeptides CyclicLipopeptidesSolanum lycopersicumPseudomonasABC transporters Lux R transcriptional regulators non-ribosomal peptide synthetaseTobaccoPeptide SynthasesLux R transcriptional regulatorsnon-ribosomal peptide synthetasePhylogenyVLAGPlant DiseasesCell-Free SystemVirulenceputisolvin-iisyringae pv.-syringaeSettore AGR/12 - Patologia VegetaleOriginal Articlesgram-negative bacteriapeptideBiosynthetic PathwayssyringomycinRepressor ProteinssyringopeptinFood Quality and DesignABC transportersGenesGenes BacterialMultigene FamilyHost-Pathogen InteractionsMutationTrans-ActivatorsATP-Binding Cassette Transportersquorum-sensing system
researchProduct

The rise and the fall of a Pseudomonas aeruginosa endemic lineage in a hospital

2021

The biological features that allow a pathogen to survive in the hospital environment are mostly unknown. The extinction of bacterial epidemics in hospitals is mostly attributed to changes in medical practice, including infection control, but the role of bacterial adaptation has never been documented. We analysed a collection of Pseudomonas aeruginosa isolates belonging to the Besançon Epidemic Strain (BES), responsible for a 12year nosocomial outbreak, using a genotype-to-phenotype approach. Bayesian analysis estimated the emergence of the clone in the hospital 5 years before its opening, during the creation of its water distribution network made of copper. BES survived better than the refe…

DNA Bacterialparallel evolutionLineage (genetic)Genomic IslandsPathogens and EpidemiologyBiologymedicine.disease_causeAmoeba (operating system)Disease OutbreaksMicrobiology03 medical and health sciencesAntibiotic resistanceDrug Resistance Multiple BacterialGenomic islandbacterial pathogensmedicineHumansPseudomonas InfectionsPathogenGenome size[SDV.MP] Life Sciences [q-bio]/Microbiology and ParasitologyResearch Articles030304 developmental biology0303 health sciencesoutbreak030306 microbiologyPseudomonas aeruginosahigh-risk cloneOutbreakBayes TheoremSequence Analysis DNAGeneral MedicineHospitals3. Good healthPhenotype[SDV.MP]Life Sciences [q-bio]/Microbiology and ParasitologyPseudomonas aeruginosa
researchProduct

Arbuscular mycorrhizal fungi influence host infection during epidemics in a wild plant pathosystem

2022

SummaryWhile pathogenic and mutualistic microbes are ubiquitous across ecosystems and often co-occur within hosts, how they interact to determine patterns of disease in genetically diverse wild populations is unknown.To test whether microbial mutualists provide protection against pathogens, and whether this varies among host genotypes, we conducted a field experiment in three naturally-occurring epidemics of a fungal pathogen, Podosphaera plantaginis, infecting a host plant, Plantago lanceolata, in the Åland Islands, Finland. In each population, we collected epidemiological data on experimental plants from six allopatric populations that had been inoculated with a mixture of mutualistic arb…

DYNAMICS0106 biological scienceshärmätPhysiologyDIVERSITYPlant ScienceDisease01 natural sciencesLOCAL ADAPTATIONMycorrhizae1110 Plant ScienceGenotypemykorritsasienetDISEASE RESISTANCEkasvitauditheinäratamo11832 Microbiology and virology2. Zero hungerprotective symbiont0303 health scienceseducation.field_of_studyPlantagoPodosphaera plantaginisPlantsplant pathogenmycorrhizal fungitaudinaiheuttajatSusceptible individual590 Animals (Zoology)GenotypemutualismPopulationAllopatric speciationZoologyBiologyPATHOGEN METAPOPULATION010603 evolutionary biologyMULTITROPHIC INTERACTIONS10127 Institute of Evolutionary Biology and Environmental Studies03 medical and health sciencesPlantago lanceolataEcosystemSymbiosiseducationPlantagoEcosystemplant diseasemutualismi (biologia)030304 developmental biologyHost Microbial InteractionsHost (biology)INDUCED RESISTANCEFungi1314 Physiology15. Life on land11831 Plant biologybiology.organism_classificationEVOLUTIONhärmäsienetMICROBE-MICROBE INTERACTIONS570 Life sciences; biologyMicrobial Interactionspowdery mildewNew Phytologist
researchProduct

Genomic determinants of speciation and spread of the Mycobacterium tuberculosis complex

2019

14 páginas, 6 figuras

Datasets as TopicGene ExpressionBacterial lineagesPopulation genomicsNegative selectionMUTATIONPathogenSensor kinaseResearch ArticlesHistory AncientPhylogenyRecombination Genetic0303 health sciencesMultidisciplinaryHYPOTHESIS1184 Genetics developmental biology physiologySciAdv r-articlesLINEAGE3. Good healthPast and presentPositive selectionMycobacterium tuberculosis complexHost-Pathogen InteractionsTwo component systemsResearch ArticleLineage (genetic)Genetic SpeciationVirulence FactorsVirulenceBiologyMicrobiologyHistory 21st CenturyRecombination eventsMycobacterium03 medical and health sciencesBacterial ProteinsGenetic algorithmGeneticsHumansTuberculosisSelection GeneticGene030304 developmental biologyGenetic locus030306 microbiologyMycobacterium tuberculosis complexesMycobacterium tuberculosisbiology.organism_classificationEVOLUTIONGenetic SpeciationGenetic LociEvolutionary biologyVIRULENCEAdaptationGenome BacterialRESISTANCE
researchProduct

Aortic stenosis: insights on pathogenesis and clinical implications

2016

Aortic stenosis (AS) is a common valvular heart disease in the Western populations, with an estimated overall prevalence of 3% in adults over 75 years. To understand its patho-biological processes represents a priority. In elderly patients, AS usually involves trileaflet valves and is referred to as degenerative calcific processes. Scientific evidence suggests the involvement of an active "atherosclerosis-like" pathogenesis in the initiation phase of degenerative AS. To the contrary, the progression could be driven by different forces (such as mechanical stress, genetic factors and interaction between inflammation and calcification). The improved understanding presents potentially new thera…

Degenerative aortic stenosisThe elderlyPathogenesiSymposium: Transcatheter aortic valve implantationAtherosclerosiClinical implicationsPathogenesisDegenerative aortic stenosiAtherosclerosisClinical implication
researchProduct

Impact of a Three Amino Acid Deletion in the CH2 Domain of Murine IgG1 on Fc-Associated Effector Functions

2008

Abstract Four murine IgG subclasses display markedly different Fc-associated effector functions because of their differential binding to three activating IgG Fc receptors (FcγRI, FcγRIII, and FcγRIV) and C1q. Previous analysis of IgG subclass switch variants of 34-3C anti-RBC monoclonal autoantibodies revealed that the IgG1 subclass, which binds only to FcγRIII and fails to activate complement, displayed the poorest pathogenic potential. This could be related to the presence of a three amino acid deletion at positions 233–235 in the CH2 domain uniquely found in this subclass. To address this question, IgG1 insertion and IgG2b deletion mutants at positions 233–235 of 34-3C anti-RBC Abs were …

Deletion mutantImmunologyAntibody AffinityDown-Regulationddc:616.07BiologySubclassProtein Structure Tertiary/geneticsMiceAnimalsImmunology and AllergyAmino AcidsEffector functionsSequence DeletionMice Knockoutchemistry.chemical_classificationMice Inbred BALB CMice Inbred NZBAnemia Hemolytic Autoimmune/genetics/immunologyReceptors IgGAutoantibodyAmino Acids/chemistry/genetics/metabolismIgg subclassesReceptors IgG/antagonists & inhibitors/genetics/metabolismPathogenicityProtein Structure TertiaryImmunoglobulin G/genetics/metabolismImmunoglobulin Switch RegionCell biologyAmino acidImmunoglobulin Heavy Chains/biosynthesis/genetics/metabolismAntibody Affinity/geneticsBiochemistrychemistryImmunoglobulin GMonoclonalMutagenesis Site-DirectedAnemia Hemolytic AutoimmuneDown-Regulation/genetics/immunologyImmunoglobulin Heavy ChainsThe Journal of Immunology
researchProduct

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Congenital secretory diarrhoea caused by activating germline mutations in GUCY2C

2016

Objective Congenital sodium diarrhoea (CSD) refers to a form of secretory diarrhoea with intrauterine onset and high faecal losses of sodium without congenital malformations. The molecular basis for CSD remains unknown. We clinically characterised a cohort of infants with CSD and set out to identify disease-causing mutations by genome-wide genetic testing. Design We performed whole-exome sequencing and chromosomal microarray analyses in 4 unrelated patients, followed by confirmatory Sanger sequencing of the likely disease-causing mutations in patients and in their family members, followed by functional studies. Results We identified novel de novo missense mutations in GUCY2C, the gene encod…

DiarrheaMale0301 basic medicinemedicine.medical_specialtyReceptors PeptideColonGuanylinGuanosine MonophosphateMutation MissenseReceptors EnterotoxinGUANYLATE CYCLASEBiologyCHRONIC DIARRHOEAPathogenesis03 medical and health scienceschemistry.chemical_compoundsymbols.namesakeGermline mutationInternal medicineBACTERIAL ENTEROTOXINSmedicineHumansMissense mutationAbnormalities MultipleGenetic Predisposition to Disease1506Intestinal MucosaCyclic guanosine monophosphateSanger sequencingPAEDIATRIC DIARRHOEASodiumGastroenterologyInfantMolecular Reproduction Development & Genetics (formed by the merger of DBGL and CRBME)Molecular biologyIntestines030104 developmental biologyEndocrinologyIntestinal AbsorptionReceptors Guanylate Cyclase-CoupledchemistryINTESTINAL ION TRANSPORTsymbolsFemaleMetabolism Inborn ErrorsIntracellularUroguanylinGut
researchProduct