Search results for "truffles"
showing 7 items of 7 documents
Wild and cultivated mushrooms as a model of sustainable development
2013
The natural resources are currently overexploited and since 1992 the Conference of Rio de Janeiro has focused on sustainable development to safeguard our planet for future generations. The Fungi kingdom includes producers of goods and services for ecosystems and organisms widely used in the food industry. Besides, macrofungi are recognized as nontimber forest products and could be utilized as agents of environmental management through weed biocontrol and environmental improvement. Moreover, the cultivation of fungi, in particular truffles, can provide an important income in agroecosystems, especially in marginal areas, along with the development of new technologies to produce novel products…
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Antimicrobial Activity of the Desert Truffles "Tirmania pinoyi" and "Terfezia claveryi" Against Human Pathogens
2015
The development of novel antimicrobials in the struggle against pathogens and antibiotic resistance is one of the most important global challenges of our time. Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial and immune stimulating properties1. In recent years the traditional studies on epigeous higher Basidiomycetes have been joined by those on hypogeous fungi and in particular on the so-named “desert truffles”. Ali2 demonstrated that organic extraction of truffles of genus Tirmania and Terfezia possess antimicrobial activity with broad-spectrum effects against Gram positive, Gram negative, aerobic and anaerobic bacteria …
New antimicrobial peptides from Tirmania pinoyi and Terfezia boudieri in the struggle against antibiotic resistance
2017
Antibiotic resistance of common pathogenic microorganisms is a topic of great concern that has finally received media attention and entered into the political agenda of world leaders. Drug-resistant bacteria are cause of thousands of deaths worldwide, then there is an urgent need for new antimicrobials, otherwise we risk losing the ability to control effectively the infectious diseases. Such emergence can be faced looking also at not usual source of antimicrobial agents, for example medicinal mushrooms. With the objective to tackle Gram-positive and Gram-negative pathogens, we focused on two edible desert truffles mushrooms Tirmania pinoyi and Terfezia boudieri as origin of new antimicrobia…
La coltivazione del tartufo in Sicilia: risultati preliminari
2011
In recent times truffles were found in several natural forest ecosystems and reaforestation of Sicily. On the basis of these findings a number of research projects were activated. In the framework of an agreement between the Laboratory of Mycology of the Department of Botany (University of Palermo) and the Farm "Buontempo-Le Due Sicilie", located in the territory of the Madonie Natural Park, a first attempt to cultivate truffles of economic importance were carried out. In the spring of 2006 the experimental truffle-bed was developed on the basis of 100 seedlings of Corylus avellana L. inoculated with Tuber aestivum Vitt. (80%) and T. melanosporum Vittad. (20%). Besides 110 seedlings of Quer…
Characterization of key aroma compounds in Burgundy truffle
2021
International audience
Antimicrobial activity of the extracts of Terfezia claveryi and Tirmania pinoyi against gram-positive and gram-negative bacteria causal agent of dise…
2017
Tomato diseases caused by virus, bacteria and fungi have been reported worldwide and caused considerable economic losses. Among all diseases, attention is paid to those caused by bacteria. In this study, the extracts of two “desert truffles” Terfezia claveryi and Tirmania pinoyi were tested against six bacterial species, causal agent of economically important tomato diseases: Pseudomonas corrugata, P. mediterranea, P. syringae pv. tomato Pectobacterium carotovorum subsp. carotovorum, Xanthomonas vesicatoria and Clavibacter michiganensis subsp. michiganansis. The extracts from both fungal species, evaluated by agar well diffusion method, showed an antimicrobial activity against all the teste…