Search results for "Antibacterial Activity"

showing 10 items of 169 documents

Induction of Secondary Metabolites from the Marine-Derived Fungus Aspergillus versicolor through Co-cultivation with Bacillus subtilis

2019

AbstractA new cyclic pentapeptide, cotteslosin C (1), a new aflaquinolone, 22-epi-aflaquinolone B (3), and two new anthraquinones (9 and 10), along with thirty known compounds (2, 4 – 8, 11 – 34) were isolated from a co-culture of the sponge-associated fungus Aspergillus versicolor with Bacillus subtilis. The new metabolites were only detected in the co-culture extract, but not when the fungus was grown under axenic conditions. Furthermore, the co-culture extract exhibited an enhanced accumulation of the known constituents versicolorin B (14), averufin (16), and sterigmatocyctin (19) by factors of 1.5, 2.0, and 4.7, respectively, compared to the axenic fungal culture. The structures of the …

Circular dichroismMagnetic Resonance SpectroscopyStereochemistryPharmaceutical ScienceAnthraquinonesMicrobial Sensitivity TestsBacillus subtilisQuinolonesGram-Positive BacteriaPeptides CyclicMass SpectrometryAnalytical ChemistryMicechemistry.chemical_compoundTermészettudományokCell Line TumorDrug DiscoveryAnthraquinonesAnimalsKémiai tudományokAxenicPharmacologyDose-Response Relationship DrugbiologyCytotoxinsChemistryCircular DichroismOrganic ChemistryAbsolute configurationbiology.organism_classificationCoculture TechniquesAnti-Bacterial AgentsAspergillusComplementary and alternative medicineMolecular MedicineAspergillus versicolorAntibacterial activityBacteriaBacillus subtilisPlanta Medica
researchProduct

Azacoccones F-H, new flavipin-derived alkaloids from an endophytic fungus Epicoccum nigrum MK214079.

2020

Abstract Three new flavipin-derived alkaloids, azacoccones F-H (1–3), along with six known compounds (4–9) were isolated from the endophytic fungus Epicoccum nigrum MK214079 associated with leaves of Salix sp. The structures of the new compounds were established by analysis of their 1D/2D nuclear magnetic resonance (NMR) and high-resolution electrospray ionization mass spectroscopy (HRESIMS) data. The absolute configuration of azacoccones F-H (1–3) was determined by comparison of experimental electronic circular dichroism (ECD) data with reported ones and biogenetic considerations. Epicocconigrone A (4), epipyrone A (5), and epicoccolide B (6) exhibited moderate antibacterial activity again…

Circular dichroismStaphylococcus aureusAntifungal AgentsStereochemistryUstilagoElectrospray ionizationAntineoplastic AgentsMicrobial Sensitivity Testsmedicine.disease_cause01 natural sciencesRussiaMinimum inhibitory concentrationMiceAlkaloidsAscomycotaCell Line TumorDrug DiscoverymedicineEndophytesAnimalsPharmacologyBiological ProductsbiologyMolecular Structure010405 organic chemistryChemistryBasidiomycotaAbsolute configurationSalixGeneral Medicinebiology.organism_classification0104 chemical sciencesAnti-Bacterial AgentsPlant Leaves010404 medicinal & biomolecular chemistryStaphylococcus aureusAntibacterial activityEpicoccum nigrumo-PhthalaldehydeFitoterapia
researchProduct

Tetrahydroanthraquinone Derivatives from the Endophytic Fungus Stemphylium globuliferm

2015

Four new tetrahydroanthraquinone derivatives, namely, dihydroaltersolanol B (1), dihydroaltersolanol C (2), and the atropisomers acetylalterporriol D (3) and acetylalterporriol E (4), were obtained from the endophytic fungus Stemphylium globuliferum, which was isolated from Juncus acutus growing in Egypt. The structures of the new compounds were unambiguously elucidated on the basis of one- and two-dimensional NMR spectroscopy, as well as by high-resolution mass spectrometry and electronic circular dichroism (ECD) spectroscopy. In addition, seven known anthraquinone derivatives 5–11 were isolated and identified on the basis of their spectral characteristics and by comparison with literature…

Circular dichroismbiologyChemistryStereochemistryOrganic ChemistryNuclear magnetic resonance spectroscopymedicine.disease_causebiology.organism_classificationPlant use of endophytic fungi in defenseMinimum inhibitory concentrationStemphylium globuliferumTermészettudományokJuncus acutusmedicinePhysical and Theoretical ChemistryAntibacterial activityKémiai tudományokEscherichia coli
researchProduct

Superior Antibacterial Activity of Integral Lemon Pectin Extracted via Hydrodynamic Cavitation

2020

Abstract Pectin extracted via hydrodynamic cavitation in water only from waste lemon peel and further isolated via freeze drying displays significant antibacterial activity against Staphylococcus aureus, a Gram positive pathogen which easily contaminates food. The antibacterial effect of the new IntegroPectin is largely superior to that of commercial citrus pectin, opening the way to advanced applications of a new bioproduct now obtainable in large amounts and at low cost from citrus juice industry's waste.

CitrusStaphylococcus aureusfood.ingredientPectinAntibacterial effectCITRUS JUICE010402 general chemistrymedicine.disease_cause01 natural scienceslcsh:Chemistrycitrus flavonoidsFreeze-dryingfoodhydrodynamic cavitationmedicineHumansCitrus PectinFood scienceIntegroPectinpectinWaste ProductsLemon peel010405 organic chemistryChemistryPlant ExtractsCommunicationfood and beveragesGeneral ChemistryCommunications0104 chemical sciencesAnti-Bacterial AgentsFruit and Vegetable Juicesantibacteriallcsh:QD1-999Staphylococcus aureusFruitHydrodynamicsPectinsAntibacterial activityChemistryOpen
researchProduct

Seasonal variations of antimicrobial activity and chemical composition of essential oils extracted from three Citrus limon L. Burm. cultivars

2014

In order to investigate the seasonal variations of antimicrobial properties and chemical composition of essential oils (EOs), three different cultivars of Citrus limon L. Burm. spp. (Femminello Santa Teresa, Monachello and Femminello Continella) were collected at 6-week intervals, from December 2012 to April 2013, for a total of four harvests. The EOs were extracted from lemon peel by hydro-distillation. The antimicrobial activity, tested by paper disc diffusion method, was evaluated against common food-related pathogenic bacteria (Listeria monocytogenes, Staphylococcus aureus, Salmonella enterica and Enterobacter spp.). EOs were more effective against Gram-positive than Gram-negative bacte…

CitrusStaphylococcus aureusfoodborne pathogenSettore AGR/13 - Chimica AgrariaEnterobacterMicrobial Sensitivity TestsPlant ScienceSettore MED/42 - Igiene Generale E Applicatamedicine.disease_causeBiochemistryessential oilGas Chromatography-Mass SpectrometryAnalytical Chemistryantibacterial activityAnti-Infective AgentsGram-Negative BacteriaBotanyOils Volatilemedicinechemical compositionCultivarChemical compositionbiologyseasonal variationsOrganic ChemistrySalmonella entericaPathogenic bacteriaEnterobacterAntimicrobialbiology.organism_classificationListeria monocytogenesSettore AGR/03 - Arboricoltura Generale E Coltivazioni ArboreeHorticulturelemon fruitItalyFruitSeasonsGas chromatographyGas chromatography–mass spectrometryAntibacterial activitySettore AGR/16 - Microbiologia Agraria
researchProduct

The Mucus of Actinia equina (Anthozoa, Cnidaria): An Unexplored Resource for Potential Applicative Purposes

2015

The mucus produced by many marine organisms is a complex mixture of proteins and polysaccharides forming a weak watery gel. It is essential for vital processes including locomotion, navigation, structural support, heterotrophic feeding and defence against a multitude of environmental stresses, predators, parasites, and pathogens. In the present study we focused on mucus produced by a benthic cnidarian, the sea anemone Actinia equina (Linnaeus, 1758) for preventing burial by excess sedimentation and for protection. We investigated some of the physico-chemical properties of this matrix such as viscosity, osmolarity, electrical conductivity, protein, carbohydrate, and total lipid contents. Som…

CnidariaErythrocytesCarbohydratesPharmaceutical ScienceSea anemonePolysaccharideActinia equina; Antibacterial activity; Cytotoxicity; Hemolytic activity; Mucus; Tumor cell line K562; Drug Discovery3003 Pharmaceutical ScienceArticleActinia equinaBiological FactorsCnidarian Venomsantibacterial activityDry weightCell Line TumorAnthozoaDrug DiscoveryAnimalsHumanshemolytic activitylcsh:QH301-705.5Pharmacology Toxicology and Pharmaceutics (miscellaneous)chemistry.chemical_classification<i>Actinia equina</i>tumor cell line K562biologyCytotoxinsHemolytic AgentsEcologyDrug Discovery3003 Pharmaceutical SciencemucuAnthozoabiology.organism_classificationInvertebratesMucusAnti-Bacterial AgentsMucusSea Anemoneslcsh:Biology (General)chemistryBiochemistryMucucytotoxicityRabbitsK562 CellsAntibacterial activityActiniaMarine Drugs
researchProduct

Zn(II)-alloferon complexes - Similar sequence, different coordination modes, no antibacterial activity.

2020

Often, in the search for a highly defined scientific phenomenon, a different one becomes apparent. This was also the case of this work, in the scope of which we planned to search for metal-enhanced, novel antibacterial/ antifungal compounds. Instead, we denied the existence of such and revealed the details of the bioinorganic chemistry of Zn(II)-alloferon complexes. Zinc(II) complexes of alloferon 1 and 2, ligands with a sequential difference of one amino acid only, show a substantially different coordination pattern at physiological pH. In the case of Zn(II)-alloferon 1 species, a histamine-like binding mode is observed (N-terminal amine and imidazole of His-1) and the coordination sphere …

Coordination sphereAlloferon; Metal-antimicrobial peptide complex; Metal-peptide thermodynamics; Zinc(II)StereochemistryProton Magnetic Resonance Spectroscopychemistry.chemical_elementZincMicrobial Sensitivity Tests010402 general chemistryLigands01 natural sciencesBiochemistryMass SpectrometryInorganic ChemistryAlloferonchemistry.chemical_compoundStructure-Activity RelationshipCoordination ComplexesImidazoleMetal-antimicrobial peptide complexHistidineAmino Acid Sequencechemistry.chemical_classificationMetal-peptide thermodynamics010405 organic chemistryBioinorganic chemistryZinc(II)0104 chemical sciencesAmino acidAnti-Bacterial AgentsZincchemistryThermodynamicsChemical stabilityAmine gas treatingAntibacterial activityPeptidesJournal of inorganic biochemistry
researchProduct

The influence of addition of Borago officinalis with antibacterial activity on the sensory quality of fresh pasta

2015

Abstract Borage (Borago officinalis L.) is a herbaceous plant of the Boraginaceae family cultivated throughout the world for several purposes, including food preparations, mainly beverages and salads. Some Italian recipes use borage as a food ingredient, in particular as condiment for pasta. The aqueous extract (AE) from borage leaves can act as biopreservative in foods due to its inhibition towards the main foodborne pathogen bacteria. Fresh pasta, due to the high content of water, is a food product with a limited shelf life. In order to test the suitability of borage to produce fresh pasta with a prolonged shelf life, borage AE was used in dried form as a raw material for the production o…

Cultural StudiesPreservativeFresh pastaFlavourSettore AGR/04 - Orticoltura E FloricolturaBorageShelf lifeIngredientFreshpastaFood scienceSensoryevaluationBorageSensory evaluationbiologyAqueous extractsBoraginaceaebiology.organism_classificationHorticultureAqueous extractAntibacterialactivityOfficinalisAqueous extracts;Antibacterialactivity;Borage;Freshpasta;SensoryevaluationBoragoAntibacterial activityFood ScienceSettore AGR/16 - Microbiologia AgrariaInternational Journal of Gastronomy and Food Science
researchProduct

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Isolation, structure elucidation, and biological evaluation of the unusual heterodimer chrysoxanthone from the ascomycete IBWF11-95A

2009

Chrysoxanthone, an unusual heterodimer of blennolide A and 2-hydroxychrysophanol linked through a diaryl ether bridge, was isolated from mycelia of the ascomycete IBWF11-95A grown in submerged culture. Its structure was elucidated by two-dimensional NMR spectroscopy. The metabolite shows antibacterial activity against different species with MIC values between 2.5 and 20 μg/mL while also inhibiting the growth of several fungi.

Diaryl etherStereochemistryMetaboliteOrganic ChemistryNuclear magnetic resonance spectroscopyIsolation (microbiology)Biochemistrychemistry.chemical_compoundchemistryMic valuesDrug DiscoveryAntibacterial activityMyceliumBiological evaluationTetrahedron Letters
researchProduct