Search results for "FLE"
showing 10 items of 3517 documents
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Riflessioni sul design inclusivo
2017
Nel 2015 presso la Città della Scienza di Napoli si è tenuto un workshop internazionale con designer e ricercatori italiani e olandesi sulla progettazione di spazi “dedicati alle attività culturali”. Pete Kercher, vicepresidente di “Design for All Italia” e Ambasciatore di “EIDD Design for All Europe DfA”, nel suo intervento ha affrontato il tema del "design inclusivo" o Design for All per l’elaborazione di strategie e di metodologie progettuali indirizzate alla ricerca di soluzioni innovative per abbattere le attuali barriere cognitive e culturali e aumentare l’accessibilità e la partecipazione di tutti gli individui a ogni attività sociale. Una nuova progettazione, quindi, inclusiva e oli…
Mapping and holistic design of natural hydraulic lime mortars
2020
Supplementary data to this article can be found online at https://doi.org/10.1016/j.cemconres.2020.106167.
Comparative study of reflectance cells for PLS-FTIR determination of sugars in soft drinks
1998
A comparative study has been carried out between a horizontal Attenuated Total Reflectance (h-ATR) cell and a Cylindrical Internal Reflection (CIR) cell (CIRCLE cell). Both cells were employed for the determination of glucose, fructose, sucrose and total sugar in soft drinks and fruit juices using absorbance measurements at two resolution values (4 and 8 cm–1). Data were processed by Partial Least Squares regression (PLS). Using a resolution of 4 cm–1, mean relative errors of prediction from 0.6% to 1.3% were obtained using the horizontal-ATR and from 0.6% to 2.8% using the CIRCLE cell resulting in a limit of detection from 0.03% in the case of sucrose to 0.21% for total sugar for the h-ATR…
Improved detection limit for ammonium/ammonia achieved by Berthelot's reaction by use of solid-phase extraction coupled to diffuse reflectance spectr…
2005
Abstract The proposed procedure is based on the extraction of the indothylmol blue into C 18 solid-phase extraction (SPE) membranes and direct quantification on the membrane surface by diffuse reflectance spectroscopy. The analytical performance of the proposed method has been evaluated for standard solutions of ammonium using reflectance values, R , as well as the Kubelka–Munk function, F ( R ). The results have been compared with those obtained by the conventional method, which uses UV–vis absorption spectroscopy with a sensor-based method. The described methodology provided satisfactory linearity and reproducibility within the ammonium concentration intervals 25–250 μg L −1 and 25–500 μg…
Direct ATR-FTIR determination of sucrose in beet root.
2000
A simple and fast procedure has been developed for the direct determination of sucrose in beet root samples through attenuated total reflectance Fourier transform infrared absorbance measurements (ATR-FTIR) at 1056 cm(-1) with a baseline established between 1187 and 887 cm(-1). The method only requires a previous crushing or liquefaction of samples and it is free from matrix effects and from the interference of minoritary sugars and fermentation molecules. Aqueous solutions of sucrose can be used as standards and recovery values from 101 to 103% were found for spiked concentration levels from 3.5 to 10.5% (w/w). The limit of detection provided by this method corresponds to 0.15% (w/w) of su…
On-line gel permeation chromatography–attenuated total reflectance–Fourier transform infrared determination of lecithin and soybean oil in dietary su…
2007
Gel permeation chromatography (GPC) with attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectrometry detection has been proposed for the simultaneous determination of lecithin and soybean oil in dietary supplements. The method involves the extraction of analytes with dichloromethane in an ultrasound water bath and the injection of 2 ml of centrifuged and filtered extracts into the system integrated by two Envirogel GPC columns (19 mm x150 mm, 19 mm x 300 mm) coupled on-line. Dichloromethane was used as mobile phase. A method has been developed to select the most appropriated wavenumber to be used for the determination of each considered compound from the calculation of a…
Late results of bladder stimulation in 11 patients: followup to 4 years.
1978
Abstract Direct stimulation of the detrusor muscle offers the best possibility to evacuate the bladder in highly selected patients. During the last 4 years 11 patients have undergone implantation of a bladder pacemaker. Followup revealed that 1 patient could void only during stimulation, while 7 patients had reflex evacuation and 3 had no function at all. An exceptional case report is presented.
Contact and contactless diffuse reflectance spectroscopy: potential for recovery monitoring of vascular lesions after intense pulsed light treatment.
2011
Optical fiber contact probe diffuse reflectance spectroscopy and remote multispectral imaging methods in the spectral range of 400 to 1100 nm were used for skin vascular malformation assessment and recovery tracing after treatment by intense pulsed light. The results confirmed that oxy-hemoglobin relative changes and the optical density difference between lesion and healthy skin in the spectral region 500 to 600 nm may be successfully used for objective appraisal of the therapy effect. Color redness parameter a* = 2 is suggested as a diagnostic border to distinguish healthy skin and vascular lesions, and as the indicator of phototreatment efficiency. Valuable diagnostic information on large…
Action research and narrative inquiry: five principles for validation revisited
2012
The article continues the discussion of the five quality principles proposed by Heikkinen, Huttunen, and Syrjala, published in 2007 in Educational Action Research. In the present article, the authors reconsider the five principles: historical continuity; reflexivity; dialectics; workability; and evocativeness. These five principles are critically examined from two viewpoints. First, the authors discuss comments on the quality of the principles published in Educational Action Research, referring to contemporary discussion within the philosophy of science. Second, they review some empirical action research reports in which these principles have been applied. The authors point out some problem…