0000000001052327
AUTHOR
Riccardo Compagno
showing 25 related works from this author
Up-to-date report on the distribution ofHelianthemum lippii(Cistaceae) in Italy
2015
An up-to-date report on the distribution of Helianthemum lippii in Italy is provided also on the basis of the findings by Lojacono-Pojero in 1889 who reported the existence of a relic population in Sicily (southern Italy), which is now thought to be extinct because of human disturbance. Field excursions permitted to confirm the locus classicus reported by Lojacono-Pojero as the other Sicilian localities that have been reported more recently. Based on a careful analysis of the literature the presence of H. lippii is currently excluded in Calabria and Apulia. The main causes that threaten the habitat of H. lippii in Sicily are pointed out according to IUCN Threats Classification Scheme.
Macrofungal diversity and ecology in two Mediterranean forest ecosystems.
2014
The macrofungal species richness and community assemblages in Italian native woodlands of oaks and Carpinus betulus and non-native woodlands of Pinus spp., Cupressus sempervirens and Eucalyptus camaldulensis were examined through the collection of basidiomata and ascomata over 1 year. The sampling in Collestrada (Umbria) and Pizzo Manolfo (Sicily) forests revealed 216 species of macrofungi. The results indicate differences in macromycete richness and diversity patterns between the two sites. The dominant tree species of the two sites were different; thus, the Collestrada forests had higher mycorrhizal species richness, while the Pizzo Manolfo forest had a higher relative number of saprotrop…
A preliminary check list of macromycetes in northern Tunisia
2016
AbstractWithin the last decade, checklists of fungi of several countries have been published or updated. Nevertheless, no checklists of macromycetes have hitherto been published for Tunisia (North Africa) apart from a mycocoenological study reporting 34 listed species. This work presents a list of macromycetes collected from January 2014 to March 2015 in six governorates of northern Tunisia. One hundred and twenty-three species (117 basidiomycetes and six ascomycetes) belonging to 78 genera and 46 families were recorded.
Biodiversity, evolution and adaptation of fungi in exstreme environments
2013
Fungi play irreplaceable roles for ecosystem functioning. They may adopt different life styles, for example saprotrophs, symbionts or parasites: some species are cosmopolitan with a wide distribution and others, thanks to they ecological plasticity, may adapt to harsh environments precluded to most of life forms. In stressing conditions, their role is even more crucial for the recycling of organic matter or favouring nutrients uptake. When the conditions become really extreme and competion is low, fungi focus on extremotollerance and evolve peculiar competences to exploit natural or xenobiotic resources in the particular constraints imposed by the environment. This paper focuses on three di…
Amaurodon mustialaënsis (Basidiomycota, Thelephoraceae) new to Italy
2014
Amaurodon mustialaensis is reported for the first time from Italy. Based on Italian specimens, a brief description, microscopical and macroscopical photographs, ecological and distributional data of this rare taxon are presented.
Diversity of macrofungi and exploitation of edible mushroom resources in the National Park “Appennino Lucano, Val D'Agri, Lagonegrese” (Italy)
2015
An investigation on the macrofungal diversity of the National Park “Appennino Lucano, Val D’Agri, Lagonegrese” (Basilicata, southern Italy) was carried out, together with an evaluation of wild edible mushrooms in agro-forest ecosystems and their possible exploitation as a new source of food and revenue in rural and under-developed areas of this region. An unpublished list of 249 mushroom taxa (229 Basidiomycota and 20 Ascomycota), mostly belonging to the genera Tricholoma, Tuber, Russula, Amanita, Boletus, Lactarius, Mycena, Agaricus, Clitocybe and Hygrophorus, growing in this important natural area is provided together with ecological characterization of the recorded specimens. Inonotus ob…
The Mineral Contents of Some Boletaceae Species from Sicily (Southern Italy)
2014
Abstract Data on the accumulation of metals in wild edible and inedible macrofungi of the Boletaceae family are discussed here and compared with data reported in literature from northern Italy and other European countries, as well as from China, Brazil, and Africa. The results show a significant difference in the values detected in Sicilian fungi compared to those reported in the literature.
The genus Pleurotus in Italy
2015
On the basis of personal observations, herbarium specimens and, data reported in the literature the authors report morphological, ecological and distributive data on Pleurotus taxa from Italy. New descriptions are here provided based on the most distinctive-discriminating eco-morphological characters of twelve Pleurotus taxa.
<I>Mycena pseudoinclinata,</I> new to Italy
2012
Hypogeous fungi in Mediterranean maquis, arid and semi-arid forests
2014
Hypogeous fungi are common in arid and semi-arid areas of the Mediterranean basin and, in particular, they are found in Italy, Spain, northern African countries (especially in Morocco, Algeria, and Tunisia), and in the Middle East. These fungi and, in particular, some species belonging to the genus Tuber and the desert truffles (Terfezia spp. and Tirmania spp.) form ascomata of considerable economic value. In this review, a panorama of hypogeous fungal diversity and information on their ecology in Mediterranean arid and semi-arid ecosystems have been reported; their economical importance and cultivation potential are also underlined.
A contribution to the knowledge of myxomycetes diversity in volcanic islands
2015
A list of myxomycetes collected in Pantelleria, a volcanic island located 110 km southwest of the island of Sicily ( Italy), is presented with data on distribution. Forty-nine taxa were identified, 38 of which are new for Sicily. The myxomycete diversity of Pantelleria was also compared with that of other volcanic islands located in the Atlantic and Pacific oceans. A list of myxomycetes collected in Pantelleria, a volcanic island located 110km southwest of the island of Sicily (Italy), is presented with data on distribution. Forty-nine taxa were identified, 38 of which are new for Sicily. The myxomycete diversity of Pantelleria was also compared with that of other volcanic islands located i…
Pisolithus albus (Sclerodermataceae), a new record for Tunisia
2015
Pisolithus albus was recently collected for the first time in Tunisia. This ectomycorrhizal fungus is found associated with Eucalyptus occidentalis, a new symbiotic relationship, in the urban area of Tunis. The new record of this fungus on this tree permit to expand our knowledge on the ecology and distribution of P. albus in Tunisia. The finding is also important since this fungal symbiont has great potential in forestation efforts. Data on the morphology, molecular identification, distribution and, ecology for P. albus in Tunisia are presented for the first time.
INVESTIGATION ON OLD-GROWTH FORESTS OF SICILY: PRELIMINARY RESULTS
2014
Old-growth forests are natural forests that have developed over a long period of time, without experiencing severe, stand-replacing disturbance a fire, windstorm, or logging. According to UNEP/CBD/SBSTTA definition, an old-growth forest is a primary or a secondary forest which has achieved an age at which structure and species normally associated with old primary forests of that type have sufficiently accumulated to act as a forest ecosystem distinct from any younger age class. In a thematic contribution to the National Biodiversity Strategy, the authors report the following definition of Italian old-growth forests: Forest in which human disturbance is absent or negligible, and in which nat…
THE SAF HERBARIUM AT THE DEPARTMENT OF AGRICULTURAL AND FOREST SCIENCE (UNIVERSITY OF PALERMO)
2014
In the wide scenario of herbaria housed in the Italian Universities there are very few examples of structures mainly devoted to forest sciences and fungi in forest ecosystems. The “Regio Istituto Superiore Forestale di Vallombrosa” (Tuscany), established in 1869, was the first example of a structure that housed an herbarium with exsiccata of forest trees. In Italy, the southernmost laurea degree course in “Environmental and Forest Sciences” concern the Department of Agricultural and Forest Sciences in the University of Palermo (Sicily). Two herbaria (CAT and PAL) are currently present in Sicily with the following specialties: a) Vascular plants, bryophytes, and algae of Mediterranean area, …
Australohydnum dregeanum new to Italy
2014
We report on the first finding in Italy (and the third in Europe) of Australohydnum dregeanum. A detailed description of the macro- and micromorphological features, the ecological data, and some taxonomic remarks concerning this taxon are provided. The bluish tint in the centre of the hymenophoral surface and the non-cystidiform aspect of the marginal hyphae are previously undescribed characters.
La biodiversità fungina in ecosistemi forestali in presenza e assenza di attività selvicolturali
Nell’ambito dell’attività formativa di dottorato, mi sono occupato della relazione esistente tra la presenza e il ruolo dei funghi, della flora vascolare, dei licheni e dei muschi, con la forma di governo del bosco, in ecosistemi complessi, quali le foreste urbane. Analizzando, in dettaglio, come la gestione del bosco tende ad influire direttamente sulle dinamiche delle cenosi fungine e sulla presenza/assenza delle singole entità. Lo studio, svolto all’interno di un popolamento forestale artificiale ad Eucalyptus camaldulensis, in un popolamento forestale artificiale a Pinus sp. pl. e all’interno di un popolamento forestale artificiale con elementi di naturalità, scelta derivante dalla loro…
First Report of Agaricus aridicola in Saudi Arabia and Ecological Notes on Agaricus bisporus
2015
Agaricus aridicola is reported for the first time from Saudi Arabia while Agaricus bisporus is a new record for Northern region of Saudi Arabia. This study includes notes on taxonomy, ecology and distribution of both the species. It was also reported that the habitat of A. aridicola and A. bisporus are characterized by calcareous sandy soil, poor in organic matter, with presence of little amount of salinity.
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Mycena pseudoinclinata, new to Italy
2012
The first report of Mycena pseudoinclinata in Italy is accompanied by notes on the taxonomy, ecology, and distribution of this uncommon basidiomycete.
Up-to-date distribution, ecology and cultivation of Pleurotus eryngii (DC.) Quél. var. thapsiae Venturella, Zervakis & Saitta in Sicily
2012
Venturella et al. [1] described a new taxon named Pleurotus eryngii (DC.) Quél. var. thapsiae Venturella, Zervakis & Saitta (Madonie Mts) on Thapsia garganica L. and provided ecological data on the locus classicus. P. eryngii var. thapsiae was reported on pastures evolved, from 1000 to 1500 m a.s.l., on limestone and is characterized by a double period of fructification (autumn and spring). P. eryngii var. thapsiae is a choice wild edible mushroom belonging to a special group of Pleurotus species which appear in nature in close association with Apiaceae plants. As part of the project's census of fungi in Sicily two new localities of growth were localized in the Natural Reserves of Capo Gall…
FUNGAL DIVERSITY IN URBAN FOREST ECOSYSTEMS
2014
In past and recent times the anthropic pressure strongly influenced the dynamic of forest ecosystems in Europe and led to a drastic decrease of forest cover and distribution mainly in unmanaged areas. The term “urban and community forests” refers to the trees and forests found in urbanized settings, in the center of cities and towns, in suburbs and rural ommunities, and at the edge of wild lands. Trees in the urban environment are subjected to a number of stresses which are very different from those suffered by trees in typical rural conditions. Biodiversity has been reduced in urban areas through ecosystem destruction, degradation, and fragmentation of remaining ecosystems. Recent investig…
The nutritional and medicinal value of Pleurotus species from Italy
2015
The genus Pleurotus is a cosmopolitan group of fungi which comprises ca. 30 species and subspecific taxa. The genus Pleurotus also represents the second main group of cultivated edible mushrooms in the world. The Pleurotus species are efficient colonizers and bioconverters of lignocellulosic agro‐industrial residues into palatable human food with medicinal properties. Besides Pleurotus species demonstrates significant nutritional and their bioactive compounds (mainly polysaccharides) possess antibacterial, antibiotic, antitumor, hypocholesterolemic and immunomodulation properties. Extracts of the Mediterranean culinary‐medicinal Oyster mushrooms P. eryngii var. eryngii, P. eryngii var. feru…
Fungal biodiversity in old-growth forests of Sicily: preliminary results
2014
According to several authors an old-growth forest in Italy is a natural forest in which human disturbance is absent or negligible, and in which natural dynamics create a mosaic of all the forest regeneration phases, including the senescing one. Such phase is characterized by large old trees, deadwood (snags logs and coarse woody debris) and a vascular plant species composition that is consistent with the bio-geographical context and it includes highly specialized taxa related to the small-scale disturbance and the microhabitats resulting from structural heterogeneity. Unmanaged forests are the main refugee for rare and endangered species, including fungi. In Sicily, 472 hectares were recogn…
First records of Craterium aureonucleatum, Perichaena quadrata, and Physarum mutabile in Italy
2012
Three species of Mycetozoa, new for Italy, were identified in garrigues and maquis ecosystems on the volcanic island of Pantelleria (Sicily). The finding of Craterium aureonucleatum, Perichaena quadrata, and Physarum mutabile widens their distribution in Europe and identifies new substrata.
Contribution to the knowledge of fungal diversity in the archaeological park of Selinunte (S.-W. Sicily)
2012
The Archaelogical Park of Selinunte (S.-W.- Sicily) is included in the SIC (Sites of Community Interest) named “Dunal system Capo Granitola, Porto Palo e Foce del Belice” (code ITA010011). It includes a dunal system that is steadily towards the inland with sandy substrates which tend to characterize little evolved soils on silico-arenaceous matrix with alkaline pH. The climate of the site belong to the thermo-mediterranean belt (annual average temperature around 18 ° C), and upper dry ombrotype (average annual rainfall of 500 mm) [1]. The biotope also includes wetlands, Pinus halepensis Miller and Eucalyptus camaldulensis Dehnh reforestations, evergreen sclerophyllous vegetation with apreva…