Search results for "Bacterial activity"
showing 10 items of 178 documents
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Isolation, structure elucidation, and biological evaluation of the unusual heterodimer chrysoxanthone from the ascomycete IBWF11-95A
2009
Chrysoxanthone, an unusual heterodimer of blennolide A and 2-hydroxychrysophanol linked through a diaryl ether bridge, was isolated from mycelia of the ascomycete IBWF11-95A grown in submerged culture. Its structure was elucidated by two-dimensional NMR spectroscopy. The metabolite shows antibacterial activity against different species with MIC values between 2.5 and 20 μg/mL while also inhibiting the growth of several fungi.
Antibacterial Activity of Extracts from Some Bryophytes
2012
The antimicrobial activity of aqueous and ethanolic extracts of 11 Bryophyta species and 9 Marchantiophyta species collected in Latvia was tested against Staphylococcus aureus, Escherichia coli and Bacillus cereus. The extract of Lophocolea heterophylla inhibited the growth of B. cereus, but none of the tested extracts inhibited the growth of E. coli. 70% of bryophyte species demonstrated certain activity in relation to S. aureus. In general, 73% of ethanolic extracts and 39% of aqueous extracts exhibited antibacterial activity against S. aureus. The highest degree of antibacterial activity against S. aureus was shown by the ethanolic extract of Dicranum scoparium and aqueous extracts of At…
Fabrication of silver nanoparticles by a diethylene triamine-hyaluronic acid derivative and use as antibacterial coating
2022
In this work a synthetic protocol for the functionalization of hyaluronic acid with diethylenetriamine (DETA) was standardized. HA-DETA derivatives were characterized by NMR and proton carbon correlation analysis HSQC and HMBC to confirm chemical structure. A selected derivative was used to set up a green fabrication procedure for HA-DETA capped silver nanoparticles with the aim to achieve a polymeric based coating with potential application in the treatment of medical devices associated infections. Data from UV-visible spectroscopy, electron scanning and transmission microscope (STEM), photoelectric spectroscopy (XPS) and rheological characterization were combined to characterize the HA-DE…
Chemical composition and antimicrobial activity of the essential oils of some species of Anthemis sect. Anthemis (Asteraceae) from Sicily
2017
The chemical composition of the essential oils isolated from the aerial parts of Anthemis arvensis L. subsp. arvensis, Anthemis cretica subsp. messanensis (Brullo) Giardina & Raimondo and from flowers and leaves of Anthemis cretica subsp. columnae (Ten.) Frezén were determinated by GC–FID and GC–MS analyses. Torreyol (85.4%) was recognised as the main constituent of the Anthemis arvensis subsp. arvensis essential oil, while in the essential oils of Anthemis cretica subsp. messanensis, collected on the rock and cultivated in Hortus Botanicus Panormitanus, (E)-chrysanthenyl acetate (28.8 and 24.2% resp.), 14-hydroxy-α-humulene (8.1 and 5.3% resp.), santolina triene (8 and 5.8% resp.) and …
Residual antibacterial activity of a new modified sodium hypochlorite-based endodontic irrigation solution
2010
Objective: In this in vitro study the antibacterial substantivity of a new sodium hypochlorite-based root canal irrigant (Hypoclean) in bovine root dentin was investigated. Study Design: Ninety dentin tubes prepared from bovine incisor teeth were used. After contamination for 14 days with Enterococcus faecalis, the specimens were divided into five groups as follows: Hypoclean; Tetraclean; 5.25% sodium hypochlorite (NaOCl); infected dentin tubes (positive control); and sterile dentin tubes (negative control). Dentin chips were collected with round burs into tryptic soy broth and after culturing, the number of colony-forming units (CFU) was counted. Results: The number of CFU was minimum in t…
Caffeate and piperidine-3-ol derivatives from the stem bark of Cassia sieberiana
2019
A new caffeate derivative from the ethanol extract of the stem bark of Cassia sieberiana DC. is described herein along with the known secondary metabolites spectaline (2), iso-6-cassine (3), 3-O-methyl-chiro-inositol (4), monobehenin (5), octyl nonadecyloate (6), β-sitosterol (7), stigmasterol (8) and sitosterol 3-O-β-D-glucopyranoside (9). The chemical structures were elucidated by means of various spectroscopic and spectrometric techniques. Extract and isolated compounds were devoid of inhibitory action against the herein selected bacterial strains (MICs > 256 μg/mL) but showed capacities to reduce 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical (EC50 < 3 μg/mL) considerably better than the …
Antimicrobial Activity, in silico Molecular Docking, ADMET and DFT Analysis of Secondary Metabolites from Roots of Three Ethiopian Medicinal Plants
2021
Mathewos Anza,1 Milkyas Endale,1 Luz Cardona,2 Diego Cortes,3 Rajalakshmanan Eswaramoorthy,1 Jesus Zueco,4 Hortensia Rico,4 Maria Trelis,5 Belen Abarca2 1Department of Applied Chemistry, School of Applied Natural Science, Adama Science and Technology University, Adama, Ethiopia; 2Department of Organic Chemistry, Faculty of Chemistry, University of Valencia, Burjassot, Spain; 3Department of Pharmacology, Faculty of Pharmacy, University of Valencia, Burjassot, Spain; 4Department of Microbiology and Ecology, Faculty of Pharmacy, University of Valencia, Burjassot, Spain; 5Parasites and Health Research Group, Department of Pharmacy, Pharmaceutical Technology and Parasitology, Faculty of Pharmacy…
Synthesis and antibacterial activities of cadiolides A, B and C and analogues
2015
International audience; The one-pot multicomponent synthesis of natural butenolides named cadiolides A, B, C and analogues has been realized. The antibacterial structure activity relationship shows that the presence of phenolic hydroxyl groups and the number and position of bromine atoms on the different aromatic rings are important features for antibacterial activity, besides it was demonstrated the tolerance of both benzene and furan ring at position 3 of the butenolide nucleus. Furthermore, none of the most relevant antibacterial compounds showed any cytotoxicity in freshly isolated human neutrophils.
Antibacterial activity of the emerging Fusarium mycotoxins enniatins A, A1, A2, B, B1, and B4 on probiotic microorganisms
2014
Abstract Enniatins (ENs) are secondary metabolites produced by several Fusarium strains, chemically characterized as N-methylated cyclohexadepsipeptides. These compounds are known to act as antifungal and antibacterial agents, but they also possess anti-insect and phytotoxic properties. In this study, the antimicrobial effect of pure fractions of the bioactive compounds ENs A, A 1 , A 2 , B, B 1 , and B 4 was tested towards nine probiotic microrganisms, twenty-two Saccharomyces cerevisiae strains and nine Bacillus subtilis strains. Antimicrobial analyses were carried out the disc-diffusion method using ENs concentrations ranging from 0.2 to 20,000 ng. Plates were incubated for 24 h at 37 °C…