Search results for "bacterial activity"

showing 10 items of 178 documents

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Isolation, structure elucidation, and biological evaluation of the unusual heterodimer chrysoxanthone from the ascomycete IBWF11-95A

2009

Chrysoxanthone, an unusual heterodimer of blennolide A and 2-hydroxychrysophanol linked through a diaryl ether bridge, was isolated from mycelia of the ascomycete IBWF11-95A grown in submerged culture. Its structure was elucidated by two-dimensional NMR spectroscopy. The metabolite shows antibacterial activity against different species with MIC values between 2.5 and 20 μg/mL while also inhibiting the growth of several fungi.

Diaryl etherStereochemistryMetaboliteOrganic ChemistryNuclear magnetic resonance spectroscopyIsolation (microbiology)Biochemistrychemistry.chemical_compoundchemistryMic valuesDrug DiscoveryAntibacterial activityMyceliumBiological evaluationTetrahedron Letters
researchProduct

Antibacterial Activity of Extracts from Some Bryophytes

2012

The antimicrobial activity of aqueous and ethanolic extracts of 11 Bryophyta species and 9 Marchantiophyta species collected in Latvia was tested against Staphylococcus aureus, Escherichia coli and Bacillus cereus. The extract of Lophocolea heterophylla inhibited the growth of B. cereus, but none of the tested extracts inhibited the growth of E. coli. 70% of bryophyte species demonstrated certain activity in relation to S. aureus. In general, 73% of ethanolic extracts and 39% of aqueous extracts exhibited antibacterial activity against S. aureus. The highest degree of antibacterial activity against S. aureus was shown by the ethanolic extract of Dicranum scoparium and aqueous extracts of At…

Dicranum scopariumbiologyTraditional medicineChemistryBacillus cereusGeneral MedicineFrullania dilatatabiology.organism_classificationAntimicrobialmedicine.disease_causeCereusStaphylococcus aureusRhytidiadelphus squarrosusmedicineAntibacterial activityAdvances in Microbiology
researchProduct

Fabrication of silver nanoparticles by a diethylene triamine-hyaluronic acid derivative and use as antibacterial coating

2022

In this work a synthetic protocol for the functionalization of hyaluronic acid with diethylenetriamine (DETA) was standardized. HA-DETA derivatives were characterized by NMR and proton carbon correlation analysis HSQC and HMBC to confirm chemical structure. A selected derivative was used to set up a green fabrication procedure for HA-DETA capped silver nanoparticles with the aim to achieve a polymeric based coating with potential application in the treatment of medical devices associated infections. Data from UV-visible spectroscopy, electron scanning and transmission microscope (STEM), photoelectric spectroscopy (XPS) and rheological characterization were combined to characterize the HA-DE…

DiethylenetriamineSilverPolymers and PlasticsAg nanoparticlesHyaluronic acidOrganic ChemistryDEETMetal NanoparticlesAnti-Bacterial AgentsSettore CHIM/09 - Farmaceutico Tecnologico ApplicativoMaterials ChemistryPolyaminesAntibacterial activityMedical device infections
researchProduct

Chemical composition and antimicrobial activity of the essential oils of some species of Anthemis sect. Anthemis (Asteraceae) from Sicily

2017

The chemical composition of the essential oils isolated from the aerial parts of Anthemis arvensis L. subsp. arvensis, Anthemis cretica subsp. messanensis (Brullo) Giardina & Raimondo and from flowers and leaves of Anthemis cretica subsp. columnae (Ten.) Frezén were determinated by GC–FID and GC–MS analyses. Torreyol (85.4%) was recognised as the main constituent of the Anthemis arvensis subsp. arvensis essential oil, while in the essential oils of Anthemis cretica subsp. messanensis, collected on the rock and cultivated in Hortus Botanicus Panormitanus, (E)-chrysanthenyl acetate (28.8 and 24.2% resp.), 14-hydroxy-α-humulene (8.1 and 5.3% resp.), santolina triene (8 and 5.8% resp.) and …

Drug Evaluation PreclinicalRaimondoAnthemis arvensisFlowersMicrobial Sensitivity TestsPlant Science01 natural sciencesBiochemistryGas Chromatography-Mass Spectrometryessential oillaw.inventionAnalytical Chemistrychemistry.chemical_compoundBridged Bicyclo CompoundsAnti-Infective Agentsantibacterial activitylawSantolinaBotanyOils VolatileAnthemisSettore BIO/15 - Biologia FarmaceuticaChemical compositionSicilyAnthemis arvensis L. subsp. arvensiEssential oiltorreyolBicyclic MonoterpenesPolycyclic Sesquiterpenesalpha-PineneEucalyptolbiology010405 organic chemistryOrganic ChemistryAnthemis cretica subsp. columnae (Ten.) FrezénAsteraceaebiology.organism_classificationCyclohexanols0104 chemical sciencesPlant Leaves010404 medicinal & biomolecular chemistryEucalyptolchemistryMonoterpenesAnthemis cretica subsp. messanensis (Brullo) Giardina &ampAnthemisSesquiterpenes
researchProduct

Residual antibacterial activity of a new modified sodium hypochlorite-based endodontic irrigation solution

2010

Objective: In this in vitro study the antibacterial substantivity of a new sodium hypochlorite-based root canal irrigant (Hypoclean) in bovine root dentin was investigated. Study Design: Ninety dentin tubes prepared from bovine incisor teeth were used. After contamination for 14 days with Enterococcus faecalis, the specimens were divided into five groups as follows: Hypoclean; Tetraclean; 5.25% sodium hypochlorite (NaOCl); infected dentin tubes (positive control); and sterile dentin tubes (negative control). Dentin chips were collected with round burs into tryptic soy broth and after culturing, the number of colony-forming units (CFU) was counted. Results: The number of CFU was minimum in t…

Endodontic irrigationSodium HypochloriteDentistryBacterial growthPolypropylenesCitric AcidEnterococcus faecalisTryptic soy brothchemistry.chemical_compoundstomatognathic systemRoot canal irrigantEnterococcus faecalisDentinmedicineAnimalsFood scienceGeneral DentistryRoot Canal IrrigantsbiologyChemistrybusiness.industrybiology.organism_classification:CIENCIAS MÉDICAS [UNESCO]Anti-Bacterial AgentsSolutionsstomatognathic diseasesmedicine.anatomical_structureOtorhinolaryngologyDoxycyclineSodium hypochloriteDentinUNESCO::CIENCIAS MÉDICASCetrimonium CompoundsCattleSurgeryAntibacterial activitybusiness
researchProduct

Caffeate and piperidine-3-ol derivatives from the stem bark of Cassia sieberiana

2019

A new caffeate derivative from the ethanol extract of the stem bark of Cassia sieberiana DC. is described herein along with the known secondary metabolites spectaline (2), iso-6-cassine (3), 3-O-methyl-chiro-inositol (4), monobehenin (5), octyl nonadecyloate (6), β-sitosterol (7), stigmasterol (8) and sitosterol 3-O-β-D-glucopyranoside (9). The chemical structures were elucidated by means of various spectroscopic and spectrometric techniques. Extract and isolated compounds were devoid of inhibitory action against the herein selected bacterial strains (MICs > 256 μg/mL) but showed capacities to reduce 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical (EC50 < 3 μg/mL) considerably better than the …

EthanolStigmasterolbiology010405 organic chemistryDPPHOrganic ChemistryPlant Sciencebiology.organism_classification01 natural sciencesBiochemistry0104 chemical sciencesAnalytical Chemistry010404 medicinal & biomolecular chemistrychemistry.chemical_compoundCassia sieberianachemistryPiperidineTroloxAntibacterial activityNuclear chemistryEC50Natural Product Research
researchProduct

Antimicrobial Activity, in silico Molecular Docking, ADMET and DFT Analysis of Secondary Metabolites from Roots of Three Ethiopian Medicinal Plants

2021

Mathewos Anza,1 Milkyas Endale,1 Luz Cardona,2 Diego Cortes,3 Rajalakshmanan Eswaramoorthy,1 Jesus Zueco,4 Hortensia Rico,4 Maria Trelis,5 Belen Abarca2 1Department of Applied Chemistry, School of Applied Natural Science, Adama Science and Technology University, Adama, Ethiopia; 2Department of Organic Chemistry, Faculty of Chemistry, University of Valencia, Burjassot, Spain; 3Department of Pharmacology, Faculty of Pharmacy, University of Valencia, Burjassot, Spain; 4Department of Microbiology and Ecology, Faculty of Pharmacy, University of Valencia, Burjassot, Spain; 5Parasites and Health Research Group, Department of Pharmacy, Pharmaceutical Technology and Parasitology, Faculty of Pharmacy…

Euphorbia schimperianaStereochemistryRanunculaceaeBiochemistry Genetics and Molecular Biology (miscellaneous)BiochemistryDNA gyrasechemistry.chemical_compoundDFT analysisUvaria scheffleriLupeolOriginal ResearchClematis burgensisbiologyDihydrochalconemolecular dockingCoumarinAntimicrobialbiology.organism_classificationComputer Science ApplicationsADMETchemistryAdvances and Applications in Bioinformatics and ChemistryChemistry (miscellaneous)Docking (molecular)antimicrobialAntibacterial activityAdvances and Applications in Bioinformatics and Chemistry : AABC
researchProduct

Synthesis and antibacterial activities of cadiolides A, B and C and analogues

2015

International audience; The one-pot multicomponent synthesis of natural butenolides named cadiolides A, B, C and analogues has been realized. The antibacterial structure activity relationship shows that the presence of phenolic hydroxyl groups and the number and position of bromine atoms on the different aromatic rings are important features for antibacterial activity, besides it was demonstrated the tolerance of both benzene and furan ring at position 3 of the butenolide nucleus. Furthermore, none of the most relevant antibacterial compounds showed any cytotoxicity in freshly isolated human neutrophils.

FarmacologiaStereochemistryCell SurvivalNeutrophilsClinical BiochemistryPrimary Cell CulturePharmaceutical ScienceMicrobial Sensitivity Tests[CHIM.THER]Chemical Sciences/Medicinal ChemistryRing (chemistry)Gram-Positive BacteriaBiochemistrychemistry.chemical_compoundStructure-Activity RelationshipCompostos orgànics Síntesi4-Butyrolactone[CHIM.ANAL]Chemical Sciences/Analytical chemistryFuranDrug DiscoveryGram-Negative BacteriaStructure–activity relationshipHumansBenzeneCytotoxicityMolecular BiologyButenolideMolecular Structure[CHIM.ORGA]Chemical Sciences/Organic chemistryOrganic ChemistryAromaticity[CHIM.CATA]Chemical Sciences/CatalysisAnti-Bacterial Agents[CHIM.THEO]Chemical Sciences/Theoretical and/or physical chemistrychemistryMolecular MedicineAntibacterial activity[CHIM.CHEM]Chemical Sciences/Cheminformatics
researchProduct

Antibacterial activity of the emerging Fusarium mycotoxins enniatins A, A1, A2, B, B1, and B4 on probiotic microorganisms

2014

Abstract Enniatins (ENs) are secondary metabolites produced by several Fusarium strains, chemically characterized as N-methylated cyclohexadepsipeptides. These compounds are known to act as antifungal and antibacterial agents, but they also possess anti-insect and phytotoxic properties. In this study, the antimicrobial effect of pure fractions of the bioactive compounds ENs A, A 1 , A 2 , B, B 1 , and B 4 was tested towards nine probiotic microrganisms, twenty-two Saccharomyces cerevisiae strains and nine Bacillus subtilis strains. Antimicrobial analyses were carried out the disc-diffusion method using ENs concentrations ranging from 0.2 to 20,000 ng. Plates were incubated for 24 h at 37 °C…

FusariumbiologyMicroorganismBacillus subtilisBacterial growthToxicologybiology.organism_classificationAntimicrobialMicrobiologylaw.inventionchemistry.chemical_compoundProbioticchemistrylawMycotoxinAntibacterial activityToxicon
researchProduct