0000000000094206
AUTHOR
Salvatore Davino
showing 121 related works from this author
Characterization and variation of bacterial and fungal communities from the sapwood of Apulian olive varieties with different susceptibility toXylell…
2020
AbstractEndophytes are symptomless fungal and/or bacterial microorganisms found in almost all living plant species. The symbiotic association with their host plants by colonizing the internal tissues has endowed them as a valuable tool to suppress diseases, to stimulate growth, and to promote stress resistance. In this context, the identification of cultivable endophytes residing the sapwood of Apulian olives might be a promising control strategy for xylem colonizing pathogens asXylella fatidiosa. To date, olive’s sapwood cultivable endophytes are still under exploration; therefore, this work pursues a study of diversity and occurrence variation of cultivable endophytes in the sapwood of di…
Molecular analysis suggests that recent Citrus tristeza virus outbreaks in Italy were originated by at least two independent introductions
2005
Citrus tristeza virus (CTV) is the causal agent of the most important virus disease of citrus. Numerous CTV isolates differing in biological and molecular characteristics have been reported worldwide. Recently, CTV was detected in Italy in several citrus crops from three separate areas: (1) Cassibile, province of Syracuse; (2) Massafra, province of Taranto; and (3) Belpasso, province of Catania. CTV isolates from Massafra and Cassibile were mild, whereas isolates from Belpasso induced severe symptoms. To study the genetic variation of CTV populations of these areas, 150 samples per area were examined by single strand conformation polymorphism (SSCP) and nucleotide sequence analysis of CTV g…
The complete genome sequence of Lamium mild mosaic virus, a member of the genus Fabavirus
2013
Springer-Verlag Wien 2013 Abstract Lamium mild mosaic virus (LMMV) is the only one of the five members of the genus Fabavirus for which there are no nucleotide sequence data. In this study, the complete genome sequence of LMMV was determined and compared with the available complete genome sequences of other members of the genus Fabavirus. The genome was the largest of the genus but maintained the typical orga- nization, with RNA 1 of 6080 nucleotides (nt), RNA 2 of 4065 nt, and an unusually long 3 0 untranslated region in RNA 2 of 603 nt. Phylogenetic analysis of the amino acid sequences of the protease-polymerase (Pro-Pol) region and the two coat proteins confirmed that LMMV belongs to a d…
Detection and identification Fabavirus species by one-step RT-PCR and multiplex RT-PCR
2014
The genus Fabavirus of the family Secoviridae comprises a group of poorly characterized viruses. To date, only five species have been described: Broad bean wilt virus 1 (BBWV-1), Broad bean wilt virus 2 (BBWV-2), Lamium mild mosaic virus (LMMV), Gentian mosaic virus (GeMV) and Cucurbit mild mosaic virus (CuMMV). The development is described of two RT-PCR procedures for the detection and identification of Fabavirus species: a one-step RT-PCR using a single pair of conserved primers for the detection of all fabaviruses, and a one-step multiplex RT-PCR using species-specific primers for the simultaneous detection and identification of the above-mentioned species of the genus Fabavirus. These m…
Detection of Parietaria Mottle Virus by RT-qPCR: An Emerging Virus Native of Mediterranean Area That Undermine Tomato and Pepper Production in Southe…
2021
Parietaria mottle virus (PMoV) is considered an emerging virus in many countries of the Mediterranean basin, especially on tomato and pepper crops. Symptoms on tomato leaves and fruits can be easily confused with those induced by cucumber mosaic virus (CMV) with necrogenic satellite RNA (CMV-satRNA), tomato spotted wilt virus (TSWV) or tomato mosaic virus (ToMV). Mixed infection of these viruses has been also reported in some tomato cultivars, with an increase in the complexity of the symptoms and severity of the disease. Although a specific serum and riboprobes have been produced, nowadays no sensitive diagnostic methods are available for the rapid PMoV detection. Here, we have developed a…
Tomato Brown Rugose Fruit Virus: Seed Transmission Rate and Efficacy of Different Seed Disinfection Treatments
2020
Tomato brown rugose fruit virus (ToBRFV) is a highly infectious virus, that is becoming a threat to tomato production worldwide. In this work we evaluated the localization of ToBRFV particles in tomato seeds, its seed transmission rate and efficacy of disinfection, and the effects of different thermal- and chemical-based treatments on ToBRFV-infected seeds&rsquo
Genetic variation and evolutionary analysis ofPepino mosaic virusin Sicily: insights into the dispersion and epidemiology
2017
Pepino mosaic virus (PepMV) is a highly infectious potexvirus that causes a severe disease in tomato (Solanum lycopersicum) crops worldwide. In Sicily, the first outbreak was detected in a single greenhouse in 2005 and it was promptly eradicated. However, in 2008, a large number of greenhouses were simultaneously affected, and it was impossible to eradicate or control the virus. This study addressed the dispersion and the genetic diversity of PepMV isolates obtained from the outbreak in Sicily, in comparison with worldwide PepMV isolates, to gain insight into the factors determining the evolution and epidemiology of the virus. A total of 1800 samples from plants with and without symptoms we…
Development of a Real-Time Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Olea Europaea Geminivirus
2022
A real-time loop-mediated isothermal amplification (LAMP) assay was developed for simple, rapid and efficient detection of the Olea europaea geminivirus (OEGV), a virus recently reported in different olive cultivation areas worldwide. A preliminary screening by end-point PCR for OEGV detection was conducted to ascertain the presence of OEGV in Sicily. A set of six real-time LAMP primers, targeting a 209-nucleotide sequence elapsing the region encoding the coat protein (AV1) gene of OEGV, was designed for specific OEGV detection. The specificity, sensitivity, and accuracy of the diagnostic assay were determined. The LAMP assay showed no cross-reactivity with other geminiviruses and was allow…
Phytophthora palmivora a New Pathogen of Lavender in Italy
2019
Root rot caused by Phytophthora nicotianae is considered the most serious disease of lavender in commercial cultivations in Italy. In summer 2001, in the Gela area (Sicily), ≈60% of 34,000 2-year-old landscape shrubs of English lavender (L. angustifolia) grown in a clay loam soil showed symptoms of dieback associated with root rot. Plants had been transplanted from pots in May and watered using a trickle irrigation system. A species of Phytophthora was isolated consistently from roots of symptomatic plants using potato dextrose agar (PDA) containing benomyl, nystatin, pentachloronitrobenzene, rifampicin, ampicillin, and hymexazol. The species was identified as P. palmivora on the basis of …
Stress responses in citrus peel: Comparative analysis of host responses to Huanglongbing disease and puffing disorder
2015
Abstract A comparison between transcriptomic responses to puffing disorder and Huanglongbing disease was conducted to decipher differences and similarities in gene and pathway regulation induced by abiotic (puffing) and biotic stresses (Huanglongbing) in citrus peel tissues. We functionally analyzed two previously published datasets: the first obtained for the study of puffing disorder using an Affymetrix citrus microarray and the second consisting of a deep sequencing analysis of symptomatic responses to Huanglongbing disease. Transcriptomic data were mined using bioinformatic tools to highlight genes and pathways playing a key role in modulating responses to different types of stress in c…
First report of Cucumber mosaic virus infecting Solanum jasminoides in Italy
2008
Solanum jasminoides Paxton (potato vine or jasmine nightshade) is a vegetatively propagated ornamental species within the Solanaceae family. Recently, symptomless plants of this species were reported as natural hosts of the quarantine pest, Potato spindle tuber viroid (PSTVd) in Italy (1). In January 2008, approximately 1,000 potted, 2-year-old plants of S. jasminoides growing in an ornamental nursery in Sicily showed virus-like mosaic and malformation of leaves. Symptoms were observed on approximately 60% of the plants. Leaf tissue, collected from 30 symptomatic and 10 symptomless plants, was analyzed by double-antibody sandwich-ELISA with polyclonal antisera specific to Cucumber mosaic v…
Community Analysis of Culturable Sapwood Endophytes from Apulian Olive Varieties with Different Susceptibility to Xylella fastidiosa
2021
Endophytes are symptomless fungal and/or bacterial microorganisms found in almost all living plant species. The symbiotic association with their host plants by colonizing the internal tissues has endowed them as a valuable tool to suppress diseases, stimulate growth, and promote stress resistance. In this context, the study of culturable endophytes residing the sapwood of Apulian olives might be a promising control strategy for xylem colonizing pathogens as Xylella fastidiosa. To date, olive sapwood cultivable endophytes are still under exploration; therefore, this work pursues a study of cultivable endophytes occurrence variation in the sapwood of different olive varieties under the effect…
Begomoviruses Infecting Tomato Crops in Panama
2015
The key regions in Panama involved in open field- and greenhouse-grown commercial tomato production, including the Chiriquí, Veraguas, Herrera, Los Santos, Coclé and Panama Oeste provinces, were surveyed for the incidence and distribution of begomoviruses in the growing seasons of 2011 and 2012. The surveys took place in 14 of the 51 districts of the above-mentioned provinces and comprised all relevant tomato production areas of the provinces. A total of 28 tomato plots were surveyed. The exact location of each plot was geo-referenced using a hand-held Global Positioning System unit. In total, 319 individual tomato plants (181 in 2011 and 138 in 2012) were sampled. Plants displayed diverse …
First report of Tomato leaf curl New Delhi virus affecting zucchini squash in an important horticultural area of southern Italy
2016
Tomato leaf curl New Delhi virus (ToLCNDV) is a bipartite begomovirus (family Geminiviridae) which infects species in the families Cucurbitaceae and Solanaceae (Padidam et al., 1995; Mizutani et al., 2011). Begomoviruses are transmitted by the whitefly Bemisia tabaci in a persistent manner (Rosen et al., 2015). In October 2015, severe symptoms not previously reported by growers in the horticultural area of the Province of Trapani (Sicily, Italy) were observed on zucchini squash (Cucurbita pepo) in open fields. The symptoms included yellow mosaic, severe leaf curling, swelling of veins of young leaves, shortening of internodes, roughness of the skin of fruit and reduced fruit size; the sympt…
Citrus rootstock breeding: response of four allotetraploid somatic hybrids to Citrus tristeza virus induced infections
2018
Four allotetraploid somatic hybrids of citrus, with potential for rootstock improvement, have been evaluated for their response to Citrus tristeza virus (CTV) infection. CTV is the most important viral pathogen affecting citrus production worldwide. Somatic combinations of ‘Milam’ lemon (Citrus jambhiri Lush.) + Sour orange (C. aurantium L Osb.), Calamondin (C. madurensis Lour.) + ‘Keen’ sour orange (C. aurantium L.), Calamondin + ‘Femminello‘ lemon (C. limon L. Burm. F.) and Cleopatra mandarin (C. reshni Hort. ex Tan.) + ‘Femminello’ lemon, were studied. Plants were grafted with CTV-infected “Valencia” sweet orange budwood. Two different CTV strains collected in Sicily, considered as “mild…
Variability Among Italian Citrus tristeza virus Isolates Revealed by SSCP Analysis, Cloning and Sequencing
2005
Revisiting the cysteine-rich proteins encoded in the 3’-proximal open reading frame of the positive-sense single-stranded RNA of some monopartite fil…
2020
A reexamination of proteins with conserved cysteines and basic amino acids encoded by the 3 '-proximal gene of the positive-sense single-stranded RNA of some monopartite filamentous plant viruses has been carried out. The cysteines are involved in a putative Zn-finger domain, which, together with the basic amino acids, form part of the nuclear or nucleolar localization signals. An in-depth study of one of these proteins, p15 from grapevine B virus (GVB), has shown: (i) a three-dimensional structure with four alpha-helices predicted by two independent in silico approaches, (ii) the nucleolus as the main accumulation site by applying confocal laser microscopy to a fusion between p15 and the g…
Real-time reverse transcription polymerase chain reaction development for rapid detection of Tomato brown rugose fruit virus and comparison with othe…
2019
Background Tomato brown rugose fruit virus (ToBRFV) is a highly infectious tobamovirus that causes severe disease in tomato (Solanum lycopersicum L.) crops. In Italy, the first ToBRFV outbreak occurred in 2018 in several provinces of the Sicily region. ToBRFV outbreak represents a serious threat for tomato crops in Italy and the Mediterranean Basin. Methods Molecular and biological characterisation of the Sicilian ToBRFV ToB-SIC01/19 isolate was performed, and a sensitive and specific Real-time RT-PCR TaqMan minor groove binder probe method was developed to detect ToBRFV in infected plants and seeds. Moreover, four different sample preparation procedures (immunocapture, total RNA extractio…
A comparative study of viral infectivity, accumulation and symptoms induced by broad bean wilt virus 1 isolates
2018
Broad bean wilt virus 1 (BBWV-1, genus Fabavirus, family Secoviridae) is a bipartite positive-sense single-stranded RNA virus distributed worldwide infecting many herbaceous species. Until now, scarce information regarding biological properties of BBWV-1 isolates is available. This work shows a comparative study on virus infectivity (proportion of infected plants over inoculated plants), virus accumulation and symptoms induced by four genetically different BBWV-1 isolates (Ben, B41/99, NSRV and PV0548) which were mechanically inoculated on several herbaceous hosts. The four BBWV-1 isolates infected broad bean, tomato, pepper and Nicotiana benthamiana plants, whereas none of them infected cu…
Loop Mediated Isothermal Amplification: Principles and Applications in Plant Virology
2020
In the last decades, the evolution of molecular diagnosis methods has generated different advanced tools, like loop-mediated isothermal amplification (LAMP). Currently, it is a well-established technique, applied in different fields, such as the medicine, agriculture, and food industries, owing to its simplicity, specificity, rapidity, and low-cost efforts. LAMP is a nucleic acid amplification under isothermal conditions, which is highly compatible with point-of-care (POC) analysis and has the potential to improve the diagnosis in plant protection. The great advantages of LAMP have led to several upgrades in order to implement the technique. In this review, the authors provide an overview r…
Evolutionary analysis of Citrus tristeza virus outbreaks in Calabria, Italy: two rapidly spreading and independent introductions of mild and severe i…
2014
The evolution of citrus tristeza virus (CTV) from outbreaks occurred in Calabria, Italy, was compared with that of CTV outbreaks reported previously in another two proximal Italian regions, Sicily and Apulia. Examination of four genomic regions (genes p20, p25 and p23, and one fragment of open reading frame 1) showed two recombination events, and phylogenetic analysis disclosed two divergent CTV groups in Calabria: one formed by severe and the other by mild isolates. This analysis, together with others involving population genetic parameters, revealed a low migration rate of CTV between the three Italian regions, as well as significant differences in selective pressures, epidemiology and de…
First report of root and crown rot of sage caused by Phytophthora cryptogea in Italy
2019
Sages are cultivated as aromatic and ornamental plants in Italy and represent the common name of certain species of Salvia and Phlomis (family Lamiaceae). In Sicily (southern Italy) during the summer of 2001, ≈40% of 1,400 2-year-old landscape plants of S. leucantha Cav. (Mexican bush sage or velvet sage) showed symptoms of stunting, chlorosis, and gradual dieback or sudden wilt, which are associated with root and crown rot. Plants were supplied by a commercial nursery, transplanted from pots in the spring, and irrigated using a trickle system. Phytophthora was isolated consistently from roots and basal stems of symptomatic plants on a BNPRAH medium (2). The species was identified as P. cr…
First report of tomato brown rugose fruit virus infecting sweet pepper in Italy
2020
In January 2020, about 85% of a red sweet pepper (Capsicum annuum) crop in a greenhouse located in Ragusa province (Sicily, Italy) showed virus-like symptoms. Symptoms consisted of a slight mosaic and discoloration of young leaves, vein clearing on young leaves, browning of the stem with strong necrosis located in the intersection of the secondary branches, partial necrosis of the vegetative apex and marbling, mosaic and distortion of the fruits (Fig. 1). It is important to note that in 2019 the same greenhouse was cultivated with tomato, which had been removed due to extensive infection caused by Tomato brown rugose fruit virus
Evolutionary Analysis of Grapevine Virus A: Insights into the Dispersion in Sicily (Italy)
2022
Grapevine virus A (GVA) is a phloem-restricted virus (genus Vitivirus, family Betaflexiviridae) that cause crop losses of 5–22% in grapevine cultivars, transmitted by different species of pseudococcid mealybugs, the mealybug Heliococcus bohemicus, and by the scale insect Neopulvinaria innumerabilis. In this work, we studied the genetic structure and molecular variability of GVA, ascertaining its presence and spread in different commercial vineyards of four Sicilian provinces (Italy). In total, 11 autochthonous grapevine cultivars in 20 commercial Sicilian vineyards were investigated, for a total of 617 grapevine samples. Preliminary screening by serological (DAS-ELISA) analysis for GV…
First report of Tomato leaf curl Sinaloa virus infecting tomato crops in Panama
2015
In April 2011 and September 2012, virus-like symptoms were observed in open field- and greenhouse-grown tomato crops (Solanum lycopersicum) in Chiriquí, the westernmost province of Panama. Samples from symptom-bearing plants (127 in all) were collected and tested for the presence of begomoviruses by polymerase chain reaction (PCR) assays with sets of degenerated primers designed to amplify parts of the DNA-A and DNA-B components (Rojas et al., 1993; Table 1). Products of the expected sizes, obtained with both DNA-A- and DNA-B-specific primers for 49 samples, suggested infection with New World bipartite begomoviruses. This corresponds to an incidence of 26% (8 plants) in open field, and 43% …
Tomato brown rugose fruit virus: A pathogen that is changing the tomato production worldwide
2022
Tomato (Solanum lycopersicum L., family Solanaceae) represents one of the most cultivated horticultural crops worldwide, with over 5 million hectares of cultivated area and more than 182 million tons of tomato produced globally. Nevertheless, monoculture conditions, intensive selection, domestication throughout the last decades, international trade of infected propagating material and climate changes intensely favoured the establishment of many pathogens and the rapid spread of new diseases, allowing organisms to establish in new and unfavourable environments. Among different biotic agents, viruses are the most dangerous, because of their rapid diffusion and production losses. Here, we revi…
Detection of Southern tomato virus by molecular hybridisation
2017
Globularia nudicaulis, a new host of Cucumber mosaic virus
2006
) is a perennial, foundnaturally on European mountains at altitudes between 900 and 2000 m.In June 2004, G. nudicaulis plants, with a yellow mosaic and/or variega-tion on malformed leaves, were noted among plant species cultivated in theBotanical Garden at Bologna University, Italy. No elongated virus-likeparticles were observed in affected-leaf extracts by transmission electronmicroscopy using a leaf dip method. By applying a protein A sandwichenzyme-linked immunosorbent assay (PAS-ELISA) technique ( Edwards Csystemic symptoms were observed in Nicotiana tabacum , N. benthamiana ,N. glutinosa, N. clevelandii and Capsicum annuum, and Cucumis sativusand C. melo. Reverse transcription-polymera…
Rapid detection and discrimination of fabaviruses by flow-through hybridisation with genus- and species-specific riboprobes
2015
Viruses cause significant damage in agricultural crops worldwide. Disease management requires sensitive and specific tools for virus detection and identification. Also, detection techniques need to be rapid to keep pace with the continuous emergence of new viral diseases. The genus Fabavirus is composed of five viruses infecting many economically important crops worldwide. This research describes the development of a procedure based on flow-through hybridisation (FTH), which is faster than and as sensitive as conventional hybridisation for virus detection in tissue-prints from infected plants. Six digoxigenin-labelled RNA probes were synthesised with two levels of specificity: (a) five spec…
Synergistic Effects of Trichoderma harzianum, 1,3 Dichloropropene and Organic Matter in Controlling the Root-Knot Nematode Meloidogyne incognita on T…
2022
Environmental concerns raised by synthetic nematicides are encouraging integrated management strategies based on their combination with non-chemical control tools, such as biocontrol agents and/or organic amendments. In this study, the combination of the fumigant 1,3-dichloropropene (1,3-D) with a commercial formulation of the biocontrol agent Trichoderma harzianum (TH) and an organic fertilizer (OF) was investigated in two consecutive tomato crops for its effect on the root-knot nematode Meloidogyne incognita and plant growth and yield. The application of 1,3-D was only performed on the first crop, while TH and OF were provided to both crops. Almost all treatments significantly reduced nem…
First report of grapevine fleck virus in vineyards of Bosnia and Herzegovina
2020
Grapevine is one of the most important fruit crops in Bosnia and Herzegovina with an annual production of around 40 thousand tons in 2018 (FAOSTAT, http://www.fao.org/ faostat/en/#data/QC). Production of grapevine in the country is mainly concentrated in vineyards in the Lištica and Mostar regions of Herzegovina with the two predominant autochthonous cultivars ‘Žilavka’ and ‘Blatina’. Grapevine fleck virus (GFkV) from the genus Maculavirus in the family Tymoviridae is a phloem limited virus with a positive-sense single-stranded RNA genome (Dreher et al. 2012). GFkV is associated with fleck disease of Vitis spp. In order to investigate the current status of GFkV in Bosnia and Herzegovina, 80…
Population genetics of cucumber mosaic virus infecting medicinal, aromatic and ornamental plants from northern Italy
2012
An epidemiological survey carried at the Herb Garden of Casola Valsenio (Emilia Romagna region; Northern Italy) from 2006 to 2009 resulted in finding Cucumber mosaic virus (CMV) as the infectious agent of several ornamental, medicinal and aromatic plants. All CMV-infected plant species showed leaf symptoms followed, in some cases, by flower colour-breaking and stunting. Genetic analysis consisted in the characterization of movement protein gene of each CMV-isolate by single strand polymorphism analysis and sequencing. Phylogenetic trees identified only two isolates as member of subgroup II, while all other isolates were part of subgroup IA. This survey confirms an unexpected increment of CM…
RNA2-encoded VP37 protein of Broad bean wilt virus 1 is a determinant of pathogenicity, host susceptibility, and a suppressor of post-transcriptional…
2020
Abstract Broad bean wilt virus 1 (BBWV‐1, genus Fabavirus, family Secoviridae) is a bipartite, single‐stranded positive‐sense RNA virus infecting many horticultural and ornamental crops worldwide. RNA1 encodes proteins involved in viral replication whereas RNA2 encodes two coat proteins (the large and small coat proteins) and two putative movement proteins (MPs) of different sizes with overlapping C‐terminal regions. In this work, we determined the role played by the small putative BBWV‐1 MP (VP37) on virus pathogenicity, host specificity, and suppression of post‐transcriptional gene silencing (PTGS). We engineered a BBWV‐1 35S‐driven full‐length cDNA infectious clone corresponding to BBWV‐…
Integrated management strategies of Meloidogyne incognita and Pseudopyrenochaeta lycopersici on tomato using a Bacillus firmus-based product and two …
2019
Abstract Because of the restrictions on chemical pesticide use and their negative effects on the environment, as well as on human and animal health, alternative strategies for plant pest and pathogen managements are highly desirable. The objective of this work was to evaluate the suitability of a commercial formulation of Bacillus firmus strain 1-1582, applied either alone or in combination with oxamyl or fosthiazate, to control the southern root-knot nematode Meloidogyne incognita and the fungal plant pathogen Pseudopyrenochaeta lycopersici under greenhouse conditions during two tomato crop cycles. Application of B. firmus suppressed nematode population levels during the second crop cycle …
Survey of Citrus tristeza virus in Southern Italy
2010
After a recent detection of Citrus tristeza virus (CTV) in Calabria (Southern Italy), an investigation was initiated in the spring 2006 to survey for the virus in this Region. The survey showed that CTV was not present in the nurseries which indicated that citrus mother plants and citrus plantlets ready for marketing have fulfilled completely the phytosanitary requirements. CTV was not detected in citrus-growing areas of Catanzaro, Cosenza and Crotone Provinces, but was found, at different levels in infected plants, in some orchards located in the Reggio Calabria and Vibo Valentia Provinces. Since the virus was detected not only in material illegally imported from abroad but also in local v…
Antagonism and Antimicrobial Capacity of Epiphytic and Endophytic Bacteria against the Phytopathogen Xylella fastidiosa
2022
Olive quick decline syndrome (OQDS), which is caused by Xylella fastidiosa, poses a severe threat to the agriculture of Mediterranean countries and causes severe damage to the olive trees in Italy. Since no effective control measures are currently available, the objective of this study was the screening of antagonistic bacteria that are potentially deployable as biocontrol agents against X. fastidiosa. Therefore, two approaches were used, i.e., the evaluation of the antagonistic activity of (i) endophytic bacteria isolated from two different cultivars of olive trees (Leccino and Ogliarola salentina) and (ii) epiphytic bacteria isolated from the phyllospheres of different host plant species …
Occurrence of the T36 Genotype of Citrus tristeza virus in Citrus Orchards in Sicily, Italy
2016
Recent phylogenetic studies have shown that different lineages representing mild and virulent Citrus tristeza virus (CTV) isolates have been present in Italy for a long time. The genetic structure of CTV population, based on p23 and p27 genes sequences, highlighted two main clusters referred to as T30 and VT-like, as confirmed by the full genomes sequences of two representative isolates SG29 (KC748392) and Bau282 (KC748391) (Licciardello et al. 2015). On the basis of risk analyses, regulatory measures have been outlined, including the recommendation to replace sour orange (C. aurantium) with tolerant rootstocks and to monitor the spread and the presence (if any) of different isolates not co…
High genetic stability of potato yellow mosaic Panama virus infecting tomato in Panama
2018
The relevant regions in Panama involved in commercial tomato production, including the Chiriqui, Veraguas, Herrera, Los Santos and Panama Oeste provinces, were surveyed for the distribution and genetic diversity of potato yellow mosaic Panama virus (PYMPV) in the growing seasons of 2011 and 2012. A total of 28 tomato plots were surveyed and 314 individual tomato plants were sampled. DNA was extracted from each plant for a subsequent rolling circle amplification (RCA) analysis, to confirm the presence of begomovirus infections. The samples displaying a positive RCA reaction were subsequently analysed by PCR with a specific primer pair to identify PYMPV. This virus was detected in samples col…
Broad bean wilt virus 1 encoded VP47 and SCP are suppressors of plant post-transcriptional gene silencing
2020
Broad bean wilt virus 1 (BBWV-1, genus Fabavirus, family Secoviridae) is a bipartite positive single-stranded RNA (+ssRNA) virus infecting important horticultural and ornamental crops worldwide. RNA1 encodes proteins involved in virus replication, whereas RNA2 encodes the large and small coat proteins (LCP, and SCP, respectively) and two putative movement proteins with overlapping C-terminal but different sizes: 47.2 kDa (VP47) and 37 kDa (VP37). Post-transcriptional gene silencing (PTGS) is a mechanism of gene regulation and defense against pathogens such as viruses. However, most plant viruses encode proteins called viral suppressors of RNA silencing (VSRs) which able to inhibit PTGS. Pre…
Basil (Ocimum basilicum), a new host of Pepino mosaic virus.
2009
Pepino mosaic virus (PepMV), a member of the genus Potexvirus , was first described in 1980 on pepino ( Solanum muricatum ) and was later isolated from different wild species of the genus Solanum (formerly Lycopersicon ) (Soler et al ., 2002). PepMV has been reported in several European countries and in North America, causing disease in tomato. In July 2008, plants of basil ( Ocimum basilicum ) showing interveinal chlorosis on young leaves were observed in three greenhouses in Sicily, in the area where tomato plants were found to be infected by PepMV in 2005 (Davino et al ., 2006). The disease was transmitted mechanically to Nicotiana benthamiana , producing chlorotic spots and leaf deforma…
The nucleotide sequence of a recombinant tomato yellow leaf curl virus strain frequently detected in Sicily isolated from tomato plants carrying the …
2017
In July 2016, an aggressive syndrome of tomato yellow leaf curl disease was reported in Sicily in tomato plants carrying the Ty-1 resistance gene. A total of 34 samples were collected and analyzed. Twenty-seven out of the 34 samples analyzed appeared to contain only recombinant molecules. One full sequence was obtained after cloning. Alignments and plot similarity analysis showed that the genome of the recombinant, named TYLCV-IL[IT:Sic23:16], was mostly derived from tomato yellow leaf curl virus (TYLCV), with a small region of 132 nucleotides in the non-coding region between the stem-loop and the start of the V2 ORF replaced by 124 nucleotides derived from a virus of a different species, t…
Cellulolytic activity in Aspergillus spp. contaminating livestock feeds and raw materials
2020
The contamination by Aspergillus spp. have become a global concern in food and feedstuffs and can lead to a reduction in yield and quality of agricultural products with significant economic losses. Most species of Aspergillus produce cellulose-degrading enzymes and some of them also have mycotoxigenic activity. This study aimed i) to evaluate the Aspergillus contamination in feeds (16) and row materials (32) collected in Sicily; ii) to isolate and identify fungi belonging to the genus Aspergillus and iii) to analyze their ability to produce cellulolytic enzymes. Aspergillus spp. contamination was evaluated on PDA using serial ten-fold dilution and spread plate technique (Mirabile et al., 20…
Recombination profiles between Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in laboratory and field conditions: evolution…
2012
Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl virus have co-existed in Italian tomato crops since 2002 and have reached equilibrium, with plants hosting molecules of both species plus their recombinants being the most frequent case. Recombination events are studied in field samples, as well as in experimental co-infections, when recombinants were detected as early as 45 days following inoculation. In both conditions, recombination breakpoints were essentially absent in regions corresponding to ORFs V2, CP and C4, whereas density was highest in the 3′-terminal portion of ORF C3, next to the region where the two transcription units co-terminate. The vast majority of brea…
First Report of Tomato torrado virus Infecting Tomato in Italy.
2010
In 2009 and 2010, approximately 2% of plants had disease symptoms, including initial leaflet chlorosis that later developed into necrotic spots and general necroses along the leaflet. Fruit production on affected plants was substantially reduced and necroses were also present. Total RNA was extracted from five symptomatic plant samples using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and analyzed by reverse transcription (RT)-PCR with specific primer pair: TR2F (5′ GAAGGACGAAGAGCGACTG 3′), and TR2R (5′ AAGGTAGGTATGCGTTTGC 3′) (1). The primers amplified a 575-bp fragment within the coat protein Vp23 of Tomato torrado virus (ToTV). No RT-PCR products were observed when water or asym…
Antibacterial Activity of Desert Truffles from Saudi Arabia Against Staphylococcus aureus and Pseudomonas aeruginosa
2017
Abstract Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial, and immune-stimulating properties. Traditional studies of epigeous higher Basidiomycetes have recently been joined by studies of hypogeous fungi and, in particular, of so-called desert truffles. With the aim to obtain novel agents against bacteria of clinical importance, we focused on the edible desert truffle mushrooms Tirmania pinoyi, Terfezia claveryi, and Picoa juniperi as sources of new antimicrobial agents. In particular, we investigated the in vitro antibacterial activity of acid-soluble protein extracts (aqueous extracts) of these 3 species against the Gram-pos…
First outbreak of Pepper vein yellows virus infecting sweet pepper in Italy
2016
Sweet pepper (Capsicum annum) is an economically important crop worldwide, including Sicily where about 4,000 hectares are grown each year. In October 2015, severe symptoms not previously reported by growers in the horticultural area of the province of Trapani (Sicily, Italy) were observed on sweet pepper plants in eight different greenhouses. Symptoms included upward leaf curling, internodal shortening and interveinal yellowing. Symptoms were more evident in the upper part of the plants. These symptoms were reminiscent of those caused by poleroviruses. In the greenhouse, symptoms were evident in about 35% of the plants. Three samples per greenhouse (24 in total) were collected for analysis.
First report of Phytophthora palmivora on Coronilla valentina subsp. glauca in Italy
2019
The genus Coronilla L. (family Fabaceae), which includes several species native to central and southern Europe, such as C. varia L. (axseed or crown-vetch), C. emerus (scorpion senna), and C. valentina L., is used in Italy as a landscape shrub or potted ornamental plant. During the summer of 2001, 80% of approximately 10,000 1-year-old plants of C. valentina subsp. glauca (L.) Batt. used to landscape an industrial area in the Caltanissetta Province (Sicily) showed symptoms of dieback associated with basal stem and root rot. Plants had been transplanted from pots in April and watered using a trickle irrigation system. A species of Phytophthora was isolated consistently from rotted roots and…
Emergence of tomato leaf curl New Delhi virus in Italy: estimation of incidence and genetic diversity
2019
Tomato leaf curl New Delhi virus (ToLCNDV) is a bipartite begomovirus (family Geminiviridae) identified for the first time in 1995 in Asia, from where it spread into several countries of the Mediterranean basin. ToLCNDV was found in Spain in 2012, and subsequently in Tunisia and Italy. The first outbreak in Italy occurred at the end of 2015 in Trapani province (Sicily) on zucchini squashes. Then in 2016, ToLCNDV was found in infected zucchini plants in Campania, Lazio and Sardinia regions, and in 2017 in Calabria. This study addressed the dispersion and genetic diversity of ToLCNDV isolates in Italy. A total of 1400 plants were analysed. Phylogenetic analysis showed low variability among th…
Survey of the distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) in Lazio region (Central Italy): a threat for the northward expansion of Tomato…
2018
Bemisia tabaci (Hemiptera: Aleyrodidae) is responsible for severe damage to horticultural and ornamental crops worldwide, mainly for its role as virus vector. In Italy, the B. tabaci Mediterranean (MED) and Middle East–Asia Minor 1 (MEAM1) cryptic species are widespread in the Southern regions as well as in Sicily and Sardinia. During the last two decades, MED populations progressively increased, in those areas where intensive farming is applied. The recent introduction of the begomovirus Tomato leaf curl New Delhi virus (ToLCNDV) prompted extensive surveys of both vector and symptomatic plants. In 2016 and 2017, monitoring activities were carried out in Lazio region (Central Italy) where b…
Epidemiological Survey of Grapevine Leafroll-Associated Virus 1 and 3 in Sicily (Italy): Genetic Structure and Molecular Variability
2022
Background: the most widely distributed and virulent Grapevine leafroll-associated viruses (GLRaV) that affect grapevine are GLRaV-1 and GLRaV-3, transmitted semi-persistently by different mealybugs and soft scales, mainly causing downward rolling of the leaf margins and interveinal reddening. Methods: the main objectives of this study were to investigate the genetic structure and molecular diversity of GLRaV-1 and GLRaV-3 in 617 samples from 11 autochthonous Sicilian grapevine cultivars, ascertaining their presence and spread. The detection was implemented by serological and molecular analyses and subsequently phylogenetic analyses on selected Sicilian isolates were conducted. Results: in …
Simultaneous detection of the seven main tomato-infecting RNA viruses by two multiplex reverse transcription polymerase chain reactions
2012
Cucumber mosaic virus, Tomato spotted wilt virus, Tomato mosaic virus, Tomato chlorosis virus, Pepino mosaic virus, Torrado tomato virus and Tomato infectious chlorosis virus cause serious damage and significant economic losses in tomato crops worldwide. The early detection of these pathogens is essential for preventing the viruses from spreading and improving their control. In this study, a procedure based on two multiplex RT-PCRs was developed for the sensitive and reliable detection of these seven viruses. Serial dilutions of positive controls were analysed by this methodology, and the results were compared with those obtained by ELISA and singleplex versions of RT-PCR. The multiplex and…
Emergence and Phylodynamics of Citrus tristeza virus in Sicily, Italy
2013
Citrus tristeza virus (CTV) outbreaks were detected in Sicily island, Italy for the first time in 2002. To gain insight into the evolutionary forces driving the emergence and phylogeography of these CTV populations, we determined and analyzed the nucleotide sequences of the p20 gene from 108 CTV isolates collected from 2002 to 2009. Bayesian phylogenetic analysis revealed that mild and severe CTV isolates belonging to five different clades (lineages) were introduced in Sicily in 2002. Phylogeographic analysis showed that four lineages co-circulated in the main citrus growing area located in Eastern Sicily. However, only one lineage (composed of mild isolates) spread to distant areas of Sici…
Transmissibility ofBroad bean wilt virus 1by aphids: influence of virus accumulation in plants, virus genotype and aphid species
2012
Broad bean wilt virus 1 (BBWV-1) is transmitted by several aphid species in a non-persistent manner. Transmission efficiency by vectors is a key factor for understanding virus epidemiology and applying disease control measures based on limiting virus spread. We evaluated the transmission rates of two genetically divergent BBWV-1 isolates (PV-132 from USA and Ben from Spain) infecting broad bean (Vicia faba L.) by isofemale lines of nine aphid species from eight different genera collected in Spain. Our analyses showed that: (a) the virus concentration in the source plant was a key factor in BBWV-1 transmissibility; (b) The Spanish isolate Ben was transmitted more efficiently than the America…
Spread of tomato brown rugose fruit virus in sicily and evaluation of the spatiotemporal dispersion in experimental conditions
2020
Tomato brown rugose fruit virus (ToBRFV) is an emerging pathogen that causes severe disease in tomato (Solanum lycopersicum L.) crops. The first ToBRFV outbreak in Italy occurred in 2018 in several Sicilian provinces, representing a serious threat for tomato production. In the present work, the spatiotemporal displacement of ToBRFV in Sicily was evaluated, analyzing a total of 590 lots of tomato seed, 982 lots of plantlets from nurseries and 100 commercial greenhouses. Furthermore, we investigated the ToBRFV spreading dynamic in a greenhouse under experimental conditions. Results showed several aspects related to ToBRFV dispersion in protected tomato crops. In detail, an important decrease …
Experimental analysis of the potential validity of Lorenzini’s hypothesis to treat COVID-19 patients
2021
The present research was aimed at testing the potential validity of Lorenzini’s hypothesis against Covid-19, based on the use of far UV-C rays directly on the patient’s ill lungs, so to significantly reduce the virus presence and with it the interstitial pneumonia, the cause of most deaths. Not having had the chance to experiment directly on the SARS-CoV-2, we shifted to a plant virus called TSWV, which has some common characteristics with SARS-CoV-2, so making our tests significant. The virus was suitably utilized so to affect an opportune range of pepper plants, after a treatment with 2 UV-C lamps, of which just one spreading far UV-C rays. Results showed that the effect of a quick exposi…
The complete nucleotide sequence of an isolate of Tomato yellow leaf curl Sardinia virus found in Sicily
2010
Partial sequences of Tomato yellow leaf curl Sardinia virus (TYLCSV) derived from tomato samples collected in Sicily in 1999, 2002 and 2004 indicated the presence of a TYLCSV different from the one previously described as the Sic strain. Here, we report a complete DNA sequence that is classified as belonging to the TYLCSV type strain (Sar strain), confirming the co-existence in Sicily of virus populations of both strains. Moreover, comparisons between this new sequence and those of the two recombinants recently described in Sicily revealed unequivocally (99% identity) that their TYLCSV-derived portion originated from the Sar strain. © 2010 Springer-Verlag.
Genetic structure and molecular variability of grapevine fanleaf virus in sicily
2021
Grapevine fanleaf virus (GFLV) is one of the main causes of grapevine fanleaf degeneration disease (GFDD) and is present in almost all areas where grapevine is cultivated. In this work, we ascertained the presence and spread of GFLV in different commercial vineyards in four Sicilian provinces (Italy), and its genetic structure and molecular variability were studied. In detail, a total of 617 grapevine samples of 11 autochthonous grapevine cultivars were collected in 20 commercial vineyards. Preliminary screening by serological (DAS-ELISA) and molecular (RT-PCR) analyses for ArMV (arabis mosaic virus) and GFLV detection were conducted. Results obtained showed the absence of ArMV in all the s…
First Report of Tomato Brown Rugose Fruit Virus on Tomato Crops in Italy
2019
In October 2018, virus-like symptoms were observed in four different greenhouses of tomato (Solanum lycopersicum) in Ragusa province (Sicily, Italy). Symptoms consisted in mosaic, deformation, and necrosis on young leaves, and discoloration and deformations on young fruits. In total 40 symptomatic samples were collected (10 for each greenhouse). Samples were tested by reverse transcription polymerase chain reaction (RT-PCR) using specific primers for different viruses that incite similar symptoms on tomato plants: Groundnut ringspot virus (Camelo-García et al. 2014), Parietaria mottle virus (Galipienso et al. 2015), Pepino mosaic virus (Panno et al. 2012), Tobacco etch virus (Zhang et al. 2…
Multilocus typing for characterization of ‘Candidatus Phytoplasma asteris’-related strains in several ornamental species in Italy
2018
Different ornamental plants showing symptoms referable to phytoplasma presence and collected between 1993 and 2015 in various floricultural areas in north and south of Italy, enclosing Sicily, resulted to be infected by ‘Candidatus Phytoplasma asteris’-related strains, and after PCR/RFLP identification on 16Sr gene were assigned to 16SrI-B subgroup. These infected samples were employed for phytoplasma strain differentiation on tuf, groel, rp and amp genes. In particular, the 23 phytoplasma strains employed were from hydrangea (5), primula (3), gentian (2), petunia (2) and gerbera (1) samples showing flower virescence; from gladiolus samples both in vivo and in micropropagation (2) showing t…
In-Field LAMP Detection of Flavescence Dorée Phytoplasma in Crude Extracts of the Scaphoideus titanus Vector
2022
One of the most destructive diseases affecting grapevine in Europe is caused by Flavescence Dorée phytoplasma (FDp), which belongs to the 16Sr-V group and is a European Union quarantine pathogen. Although many molecular techniques such as loop-mediated isothermal amplification (LAMP) are widely used for the rapid detection of FDp in infected grapevine plants, there is no developed isothermal amplification assay for FDp detection in the insect vectors that are fundamental for the spread of the disease. For this reason, a simple in-field real-time LAMP protocol was optimized and developed for the specific detection of FDp in the insect vector Scaphoideus titanus. The LAMP assay was optimized …
Survey of five major grapevine viruses infecting Blatina and Žilavka cultivars in Bosnia and Herzegovina
2021
The sanitary status of grapevines has not yet been considered sufficiently in vineyards throughout Bosnia and Herzegovina (BiH). An extensive survey of five major grapevine viruses in the country was carried out in 2019. A total of 630 samples from the two dominant autochthonous cultivars, named Žilavka and Blatina, were tested by DAS-ELISA for the presence of grapevine leafroll-associated viruses (GLRaV-1 and 3), grapevine fleck virus (GFkV), grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV). Eighty-eight % of the samples were positive for at least one virus, and all five viruses were detected, thought with different incidence, i.e. GLRaV-3 (84%), GFLV (43%), GLRaV-1 (14%), GFk…
A Review of the Most Common and Economically Important Diseases That Undermine the Cultivation of Tomato Crop in the Mediterranean Basin
2021
Tomato (Solanum lycopersicum L.), family Solanaceae, has become in the past fifty years one of the most important and extensively grown horticultural crops in the Mediterranean region and throughout the world. In 2019, more than 180 million tonnes of tomato have been produced worldwide, out of which around 42 million tonnes in Mediterranean countries. Due to its genetic properties, tomato is afflicted by numerous plant diseases induced by fungal, bacterial, phytoplasma, virus, and viroid pathogens. Not only is its genetic inheritance of great importance to the management of the numerous tomato pathogens, but equally as important are also the present climate changes, the recently revised phy…
First Report of Tomato Leaf Curl New Delhi Virus Causing Yellow Leaf Curl of Pepper in Europe
2019
Tomato leaf curl New Delhi virus (ToLCNDV), a bipartite begomovirus (family Geminiviridae) with two circular ssDNA genome components (DNA-A and DNA-B), is transmitted in a circulative nonpropagative manner by the whitefly Bemisia tabaci (Gennadius). Although it was first reported in Asia on tomato and other solanaceous crops such as eggplant, potato, and chilli pepper in the Mediterranean basin, this virus was mainly detected on cucurbits and only sporadically on tomato and on two wild solanaceous species, Datura stramonium L. and Solanum nigrum L. (Juárez et al. 2019). In 2018, separate surveys were carried out in protected cultivations of sweet pepper (Capsicum annuum L.) in two Italian r…
Advanced methods of plant disease detection. A review
2014
International audience; Plant diseases are responsible for major economic losses in the agricultural industry worldwide. Monitoring plant health and detecting pathogen early are essential to reduce disease spread and facilitate effective management practices. DNA-based and serological methods now provide essential tools for accurate plant disease diagnosis, in addition to the traditional visual scouting for symptoms. Although DNA-based and serological methods have revolutionized plant disease detection, they are not very reliable at asymptomatic stage, especially in case of pathogen with systemic diffusion. They need at least 1–2 days for sample harvest, processing, and analysis. Here, we d…
Citrus Tristeza Virus (CTV): A serious threat to the Italian citrus groves
2004
Diffusion of two different isolates of Citrus tristeza virus in Sicily
2007
CHARACTERIZATION OF A STRAIN OF PEPINO MOSAIC VIRUS FOUND IN SICILY
2006
During winter 2005, an unusual virus-like yellow leaf disorder associated to interveinal leaf yellowing and marbling on fruits, was observed in some greenhouse tomato crops in Sicily, exactly in province of Ragusa. Two leaves from 250 symptomatic tomato plants were serologically tested by DAS-ELISA technique using the sera to Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV), Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV) and Pepino mosaic virus (PepMV). Of the 250 samples tested, 215 were positive to PepMV presence. This virus was mechanically transmitted to Cucumis sativus “Cubit”, Datura metel, Nicotiana benthamiana and tomato “Rio Grande”. The host range of…
Inula viscosa L. a new host of Cucumber mosaic virus
2010
A new method for detecting viruses that cause tomato yellow leaf curl disease in the Mediterranean region and their recombinants.
2007
Pepino mosaic virus outbreaks spread in Sicily
2009
Influenza di CMV sul metabolismo di zuccheri in Dipsacus silvestris Miller
2007
Distribution of three different isolates of Citrus Tristeza Virus in southern Italy
2010
Rapid detection and discrimination of fabaviruses by flow-through hybridisation with genus- and species-specific riboprobes
2015
Viruses cause significant damage in agricultural crops worldwide. Disease management requires sensitive and specific tools for virus detection and identification. Also, detection techniques need to be rapid to keep pace with the continuous emergence of new viral diseases. The genus Fabavirus is composed of five viruses infecting many economically important crops worldwide. This research describes the development of a procedure based on flow-through hybridisation (FTH), which is faster than and as sensitive as conventional hybridisation for virus detection in tissue-prints from infected plants. Six digoxigenin-labelled RNA probes were synthesised with two levels of specificity: (a) five spec…
Il mosaico dell’Euphorbia x lomii
2009
Spread of Pepino mosaici virus to different tomato genotype crops bumble bees.
2010
Huanglongbing (Greening): una possibile minaccia per l’agrumicoltura italiana.
2011
Antimicrobial activity of the extracts of Terfezia claveryi and Tirmania pinoyi against gram-positive and gram-negative bacteria causal agent of dise…
2017
Tomato diseases caused by virus, bacteria and fungi have been reported worldwide and caused considerable economic losses. Among all diseases, attention is paid to those caused by bacteria. In this study, the extracts of two “desert truffles” Terfezia claveryi and Tirmania pinoyi were tested against six bacterial species, causal agent of economically important tomato diseases: Pseudomonas corrugata, P. mediterranea, P. syringae pv. tomato Pectobacterium carotovorum subsp. carotovorum, Xanthomonas vesicatoria and Clavibacter michiganensis subsp. michiganansis. The extracts from both fungal species, evaluated by agar well diffusion method, showed an antimicrobial activity against all the teste…
Outbreak of Tomato infectious chlorosis virus in a relevant artichoke producing area of Sicily, Italy.
2009
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Performance of “Comune” clementine infected with citrus exocortis viroid (CEVd) on seven rootstocks
2005
Osservation on the rapid spread of Citrus tristeza virus severe isolate by Aphis gossypii Glover.
2007
Actas de Horticultura
2014
El cultivo de los cítricos comenzó en Extremo Oriente hace unos 4.000 años, en las regiones que ocupan actualmente China y Japón. Los grandes movimientos migratorios que ocasionaron las conquistas de Alejandro Magno, la expansión del Islam y el descubrimiento de América favorecieron la expansión de este cultivo por todo el mundo. Sin embargo, fue a partir del siglo XVIII cuando la citricultura adquirió una relevancia económica, tanto desde el punto de vista industrial como ornamental. El movimiento de plantas fue acompañado por la difusión de diversos patógenos, aunque afortunadamente, sólo una parte de los presentes en las regiones de origen han llegado en las nuevas áreas de cultivo. En I…
Il virus della “tristeza” degli agrumi (CTV) mette a rischio l’agrumicoltura italiana.
2011
Comportamento di genotipi di pomodoro nei confronti della malattia dell’accartocciamento fogliare giallo del pomodoro (TYLCD)
2006
Incidence and effect of Citrus tristeza virus on commercial orchard of “Tarocco” sweet orange O.L. in Italy.
2005
Il virus del mosaico del centriolo (CMV).
2005
Gli Agrumi, Virus e viroidi
2012
Indagini sul virus della tristezza degli agrumi (CTV) e sui viroidi degli agrumi.
2007
Complete sequence, genotyping and comparative analysis of Pepino mosaic virus discovered isolates from Italy
2011
Pepino mosaic virus (PepMV) causes economic damage to the tomato industry worldwide. In Italy, the virus is endemic in Sicily, an important tomato-production region, and a new outbreak has been recorded in Sardinia after the first PepMV appearance in 2001. Italian PepMV isolates from these two geographically distant regions were molecularly characterized and the complete nucleotide sequence of four isolates was determined by walking primer strategy. The complete nucleotide and deduced amino acid sequences were analyzed and compared with published PepMV sequences. Italian isolates belong to the PepMV-Ch2 strain and had 97.2% to 98.5% identity with those of the reference PepMV-Ch2 deposited i…
Fifty Years investigating citrus tristeza virus in Italy
2010
Evolution of Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia Virus in Italy: appearance of interspecific hybrids.
2007
Exocortite: viroide gli agrumi da tenere sottocontrollo
2014
Yellowing viral disorder in Tomato: occurrence of Tomato infectious chlorosis virus (TICV) in Sicily
2007
FIRST REPORT OF HOSTA VIRUS X (HVX) INFECTING HOSTA IN ITALY
2011
Species of Hosta (Liliaceae) are herbaceous perennials more often grown for their foliage (blue, gold, green or variegated) then for their flowers. Virus diseases reported elsewhere in the word on cultivated hosta species include Hosta virus X (HVX), first described in USA in 1996, and considered to be the main pathogen of this genus. In October of 2010, the following systemic virus-like symptoms were observed on leaves of three varieties cultivated in Emilia-Romagna region (Italy) (“Gold Standard”, “Sum and Substance” and “Whirlwind”): irregular green blotched scattered in the yellow lamina, green bands running along the veins having an “ink-bleeding” look, malformations, different leaf th…
Recombinacion entre los Begomovirus TYLCV y TYLCSV en Italia.
2012
Planthology: an Application System for Plant Diseases Management
2017
The goals of modern agriculture are obtaining high yields that meet the increasing nutritional requirements of the World population. This is extremely difficult for three kind of reasons: i) the lands dedicated to agricultural use are strongly reduced in industrialized Countries; ii) farmers prefer an homogeneous product, because it is easier to manage, with consequent reduction of biodiversity, iii) globalization and climate change have led to the introduction of new pathogens and pest in environments other than original ones, resulting in serious production losses. The consequences of these problems, followed by not timely intervention leads to conditions that make not possible to obtain …
Performance of “Navelina” sweet orange on five rootatocks inoculated with citrus viroids
2005
Evolution of viruses causino yellow leaf curl in tomato in Southern Italy: Coexistence of two viral species and appearance of recombinant molecules
2007
Molecular characterization of citrus tristeza virus (CTV) isolates and detection of fungi associated with Citrange root-stock in Sicilian symptomless…
2014
The first monitoring on the CTV occurrence in central-western Sicily carried out during spring 2011 in asymptomatic citrus groves, has allowed to report CTV- free citrus-growing areas (province of Caltanissetta and Trapani), the first focus in province of Agrigento and two new others in province of Palermo. Molecular analysis (RT-PCR of p18, p20 and p23 genes, single strand conformation polymorphism and partial sequencing) showed that the obtained CTV isolates had a high homology (99%) with mild CTV strains (T 30 and T 385). Moreover, survey on the genetic flow and analysis of synonymous/nonsynonymous, by MEGA 5.0 and DNAsp 5.0 programs, demonstrated the provenience of the new “tristeza” fo…
Transmissibility of Broad bean wilt virus 1 by aphids: influence of virus accumulation in plants, virus genotype and aphid species
2013
Broad bean wilt virus 1 (BBWV-1) is transmitted by several aphid species in a non-persistent manner. Transmission efficiency by vectors is a key factor for understanding virus epidemiology and applying disease control measures based on limiting virus spread. We evaluated the transmission rates of two genetically divergent BBWV-1 isolates (PV-132 from USA and Ben from Spain) infecting broad bean (Vicia faba L.) by isofemale lines of nine aphid species from eight different genera collected in Spain. Our analyses showed that: (a) the virus concentration in the source plant was a key factor in BBWV-1 transmissibility; (b) The Spanish isolate Ben was transmitted more efficiently than the America…
Genetic variability and evolutionary analysis of parietaria mottle virus: role of selection and genetic exchange
2015
[EN] The genetic variability and evolution of parietaria mottle virus (PMoV) of the genus Ilarvirus was studied by analyzing nucleotide sequences of 2b and CP genes from isolates collected in different countries. Phylogenetic analysis showed that PMoV isolates clustered in different clades: one (clade I) composed of only Italian isolates and three clades (clades II-IV) including the Spanish isolates. The Greek isolate GrT-1 used in this study was in clade IV for the CP phylogenetic tree whereas it formed a separate branch in the 2b phylogenetic tree. The nucleotide sequence diversity of both the 2b and CP genes was low (0.062 +/- A 0.006 and 0.063 +/- A 0.006 for 2b and CP, respectively) bu…
Diffusione del virus della “Tristeza” degli agrumi (CTV) in aree agrumicole italiane
2006
Preliminary investigations on the occurrence of Citrus Tristeza Virus (CTV)in central-western Sicilian orchards and on the mycorrhizal status in citr…
2013
In the last decade, since the first outbreak of Citrus tristeza virus (CTV) in the province of Catania (2002), several new CTV foci were found in Sicily. In order to determine CTV occurrence in centra-lwestern Sicily, identify and characterize viral strains and verify the mycorrhizal status of citrange [Citrus sinensis (L.) Osb. × Poncirus trifoliate (L.) Raf.]. one of the most utilized tollerant rootstock, an epidemiological survey was carried out in 2011. Symptomless samples from citrus groves from different Sicilian provinces (Agrigento, Palermo, Trapani, Caltanissetta) were collected and submitted to serological assay. Only samples from Agrigento and Palermo provinces were ELISA-positiv…
Molecular characterization and Phylogenetic analysis of Turnip mosaic virus (TuMV) in Erysimum linifolium L. in Italy
2013
In the Summer of 2012, Erysimum linifolium L. pot plants produced at an ornamental grower in Liguria region (northern Italy), showed unusual virus-like disease of dark mottle and stripes on mauve-purple petals. A virus was mechanically transmitted from symptomatic flowers to several test plant species belonging to Chenopodiaceae and Brassicaceae families. This virus was identified as an isolated of turnip mosaic virus (TuMV) by PAS-ELISA analysis, electron microscopy negatively stained crud extracts and immuno-electron microscopy (IEM) tests. In the naturally infected E. linifolium plants, TuMV occurred alone, since any other viruses either by electron microscopy or mechanical inoculations …
Incidence, distribution and diversity of Citrus tristeza virus in two different areas of Sicily
2007
Current status of Pepino mosaic virus in Italy
2010
Antimicrobial Activity of the Desert Truffles "Tirmania pinoyi" and "Terfezia claveryi" Against Human Pathogens
2015
The development of novel antimicrobials in the struggle against pathogens and antibiotic resistance is one of the most important global challenges of our time. Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial and immune stimulating properties1. In recent years the traditional studies on epigeous higher Basidiomycetes have been joined by those on hypogeous fungi and in particular on the so-named “desert truffles”. Ali2 demonstrated that organic extraction of truffles of genus Tirmania and Terfezia possess antimicrobial activity with broad-spectrum effects against Gram positive, Gram negative, aerobic and anaerobic bacteria …
Genetic diversity and evolutionary analysis of Citrus Tristeza Virus p20 gene in Pakistan: insights into the spread and epidemiology
2016
Background: Citrus tristeza virus (CTV) is a widespread disease and the most destruction causing agent of citrus. Pakistan is ranked amongst the top ten citrus producing countries around the globe and it contributes about 2% to its foreign exchange earnings. Based on this assumption it is very important to monitor and determine the evolutionary forces and the phylogeography of Pakistani CTV population. Methods: A total of 49 sequences of p20 gene from Pakistan were phylogenetically compared with CTV sequences worldwide. These sequences were analyzed for their genetic diversity and evolution using a Bayesian Probability approach and predicted secondary structure. Results: Phylogenetic analys…