0000000000899762
AUTHOR
Maria Letizia Gargano
showing 155 related works from this author
Up-to-date report on the distribution ofHelianthemum lippii(Cistaceae) in Italy
2015
An up-to-date report on the distribution of Helianthemum lippii in Italy is provided also on the basis of the findings by Lojacono-Pojero in 1889 who reported the existence of a relic population in Sicily (southern Italy), which is now thought to be extinct because of human disturbance. Field excursions permitted to confirm the locus classicus reported by Lojacono-Pojero as the other Sicilian localities that have been reported more recently. Based on a careful analysis of the literature the presence of H. lippii is currently excluded in Calabria and Apulia. The main causes that threaten the habitat of H. lippii in Sicily are pointed out according to IUCN Threats Classification Scheme.
Mycotheca of Edible and Medicinal Mushrooms at Herbarium SAF as a Potential Source of Nutraceuticals and Cultivated Mushrooms
2018
Basidiomycetes strains (n = 39) belonging to 9 genera in 8 families are kept in the mycotheca of the Department of Agricultural, Food and Forest Sciences at the University of Palermo (Palermo, Italy). All of the strains are medicinal mushrooms, and some are of great commercial and nutraceutical interest.
Macrofungal diversity and ecology in two Mediterranean forest ecosystems.
2014
The macrofungal species richness and community assemblages in Italian native woodlands of oaks and Carpinus betulus and non-native woodlands of Pinus spp., Cupressus sempervirens and Eucalyptus camaldulensis were examined through the collection of basidiomata and ascomata over 1 year. The sampling in Collestrada (Umbria) and Pizzo Manolfo (Sicily) forests revealed 216 species of macrofungi. The results indicate differences in macromycete richness and diversity patterns between the two sites. The dominant tree species of the two sites were different; thus, the Collestrada forests had higher mycorrhizal species richness, while the Pizzo Manolfo forest had a higher relative number of saprotrop…
Typification of the name orobanche ebuli huter & rigo (orobanchaceae) and its taxonomic implications
2018
The present contribution is part of the ongoing work aimed at researching and identifying the original material on which the names of Orobanche Linnaeus (1753: 632) described for Europe and the Mediterranean are based (Domina et al. 2005, Domina & Stepanek 2009, Domina et al. 2013, Carlón et al. 2015). It falls within the researches promoted by the Italian Botanical Society aimed at recognizing and typifying all the taxa described from Italy and their loci classici, in order to increase their systematic knowledge and promote further studies (Domina et al. 2012, Peruzzi et al. 2015, Brundu et al. 2017). Orobanche ebuli Huter & Rigo (1907: 354), is an Italian endemic (Peruzzi et al. 2…
Ethnobotanical investigation on wild medicinal plants in the Monti Sicani Regional Park (Sicily, Italy)
2014
Ethnopharmacological relevance The area of the "Monte Sicani Regional Park" (Central Western Sicily, southern Italy) has been quantitatively and extensively investigated in an ethnobotanical study for the first time. A total of 108 wild species are used for medicinal purposes, while, according to our study, the uses of 9 species have not previously been reported in ethnobotanical studies in Italy (e.g.; the use of Kickxia elatine (L.) Dumort. for the treatment of hyperhydrosis of the feet, the use of Lavatera agrigentina Tineo for cough and bronchitis). Aim of the study: The aim of this paper is to analyze, through quantitative indicators, the extent of the current knowledge on medicinal us…
A preliminary check list of macromycetes in northern Tunisia
2016
AbstractWithin the last decade, checklists of fungi of several countries have been published or updated. Nevertheless, no checklists of macromycetes have hitherto been published for Tunisia (North Africa) apart from a mycocoenological study reporting 34 listed species. This work presents a list of macromycetes collected from January 2014 to March 2015 in six governorates of northern Tunisia. One hundred and twenty-three species (117 basidiomycetes and six ascomycetes) belonging to 78 genera and 46 families were recorded.
The sabulicolous fungi from Sicily (southern Italy): additions and critical review
2009
The ecological and distributive data of 165 sabulicolous taxa (29 Ascomycetes and 136 Basidiomycetes), included in 89 genera and 48 families, collected in Sicily (southern Italy) are here reported. New additions are included, together with a critical review of data reported in literature for the Sicilian territory. The full checklist is available on http://www.mycotaxon.com/resources/weblists.html
A reappraisal of the Pleurotus eryngii complex – New species and taxonomic combinations based on the application of a polyphasic approach, and an ide…
2014
The Pleurotus eryngii species-complex comprises choice edible mushrooms growing on roots and lower stem residues of Apiaceae (umbellifers) plants. Material deriving from extensive sampling was studied by mating compatibility, morphological and ecological criteria, and through analysis of ITS1-5.8S-ITS2 and IGS1 rRNA sequences. Results revealed that P. eryngii sensu stricto forms a diverse and widely distributed aggregate composed of varieties elaeoselini, eryngii, ferulae, thapsiae, and tingitanus. Pleurotus eryngii subsp. tuoliensis comb. nov. is a phylogenetically sister group to the former growing only on various Ferula species in Asia. The existence of Pleurotus nebrodensis outside of S…
Trees and shrubs in the city of Bari (Italy)
2021
The authors recorded in the city of Bari 221 specific and infraspecific taxa, used as onramentals, belonging to 126 genera of 64 families with a prevalence of exotic species over native ones. The study is preparatory to the redevelopment of urban green areas concerning the recent Municipal Regulation on green spaces in the city. The flora investigated is rich in elements native to Italy. Anyway, the most common species are commonly used as ornamental also in the other regions of Italy. Argania spinosa, Ceiba speciosa, Cyperus papyrus, Euphorbia ingens, Ficus rubiginosa, and Jacaranda mimosifolia are species less commonly used and noteworthy, because at their climatic limit.
Popular uses of wild plant species for medicinal purposes in the Nebrodi Regional Park (North-Eastern Sicily, Italy)
2014
Ethnopharmacological relevance: The area of the Nebrodi Regional Park (North-Eastern Sicily, Italy) has Q3 been quantitatively investigated in an ethnobotanical study for the first time. A total of 90 wild species are used for medicinal purposes and the uses of 5 species have not previously been reported in ethnobotanical studies in Italy (e.g., the use of Arisarum vulgare O. Targ. Tozz. for the treatment of rheumatic pains, the use of Silene vulgaris (Moench) Garcke for the treatment of liver diseases). Aim of the study: The aim of this paper was to understand to what extent current knowledge on the medicinal use of plants is still an element of the culture within the rural populations of …
First report of the rare tooth fungus Hericium erinaceus in North African temperate forests
2018
The rare fungus Hericium erinaceus (Bull.) Pers. was collected from temperate forests in northwestern Tunisia and described for the first time in Africa. In this paper, we report data about the distribution, ecology, morphology and molecular identification of H. erinaceus. Collected data may help expand our knowledge on this critically endangered rare species worldwide.
Study of the effects of Pleurotuseryngii var. eryngii on heat shock proteins and cytokines levels in a mouse model of colon carcinoma
Medicinal mushrooms are wonderful source of nutraceuticals with a wide range of benefit for human health. The current anti-cancer therapy is not always target specific and often is associated with complications for patients. Therefore new effective and less toxic therapeutic approaches are needed. Heat shock proteins (Hsps) are highly expressed in a variety of cancer types contributing to tumor cell propagation. Here, we treated C26 colon cancer cells with a cold-water extracts of an edible mushrooms Pleurotuseryngii var. eryngii (Pleuery). Hsp90, 70, 60 and 27 levels were measured by western blotting and immunofluorescence analysis. Moreover, we evaluated Pleueryanti cancer effect in an an…
First report of Diplodia africana on Grevillea robusta
2020
Branch cankers and dieback were observed on silky-oak trees (Grevillea robusta) along some streets of Palermo (Sicily, Italy). Fungi isolated from symptomatic branches were identified as Diplodia africana and D. seriata by morphological characters and phylogenetic analyses of combined ITS and translation elongation factor 1-α sequences. Pathogenicity was verified by inoculating twigs of 3-y-old silky-oak plants. This is the first report of D. africana on G. robusta and the first record of D. seriata on this host in the northern hemisphere.
The Checklist of Sicilian Macrofungi: Second Edition
2022
Approximately 30 years after the publication of the first Sicilian checklist of macrofungi, a new updated version is presented here. The census of macromycetes was carried out through periodic observations in different agricultural and forest ecosystems, in urban areas, in public and private gardens, and in botanical gardens. The 1919 infraspecific taxa included in 508 genera belonging to 152 families were collected in the Sicilian territory. Ectomycorrhizal fungi are the most represented ecological category, followed by saprotrophs on wood, saprotrophs on litter, and terricolous saprotrophs. The interest in this rich group of organisms is evidenced by the nutritional and therapeutic value …
Comparison of Two Schizophyllum commune Strains in Production of Acetylcholinesterase Inhibitors and Antioxidants from Submerged Cultivation
2021
In recent years, fungi have been recognized as producers of acetylcholinesterase (AChE) inhibitors, agents important for the prevention of Alzheimer’s disease (AD). This study aimed to examine the AChE inhibitory, the antioxidative and antibacterial activity of two different Schizophyllum commune strains that originated from Serbia (SRB) and Italy (IT). Submerged cultivation of grown mycelia (M) and fermentation broth (F) of ethanol (EtOH) and polysaccharide (PSH) extracts lasted for 7, 14, 21 and 28 days. For AChE activity Ellman method was performed, while for antioxidative activity, sevendifferent assays were conducted: DPPH, ABTS, FRAP, SOA, OH, NO together with total phenolic content. …
The nutritional composition of selected wild edible mushrooms from Sicily (southern Italy)
2011
The wide consumption of wild fungi by the local population is the basis for an evaluation of the as yet unknown nutritional composition of some selected species. Wild edible mushrooms (Fistulina hepatica, Infundibulicybe geotropa, Laetiporus sulphureus, Macrolepiota procera var. procera and Suillus granulatus) were collected in a number of Sicilian (southern Italian) forest ecosystems and analysed according to standard methodologies of fungal analysis, for their basic composition (ash, water, protein, fat, carbohydrate and vitamin). The results showed that the investigated mushrooms could be suggested as a source of nutritional elements for the human diet.
Medicinal Mushrooms: Bioactive Compounds, Use, and Clinical Trials
2021
Medicinal mushrooms have important health benefits and exhibit a broad spectrum of pharmacological activities, including antiallergic, antibacterial, antifungal, anti-inflammatory, antioxidative, antiviral, cytotoxic, immunomodulating, antidepressive, antihyperlipidemic, antidiabetic, digestive, hepatoprotective, neuroprotective, nephroprotective, osteoprotective, and hypotensive activities. The growing interest in mycotherapy requires a strong commitment from the scientific community to expand clinical trials and to propose supplements of safe origin and genetic purity. Bioactive compounds of selected medicinal mushrooms and their effects and mechanisms in in vitro and in vivo clinical stu…
The Role of Medicinal Mushrooms in Brain Cancer Therapies: Review.
2021
Medicinal mushrooms are considered an unlimited source of polysaccharides (mainly β-glucans) and polysaccharide-protein complexes and possess various immunological and anticancer properties. In addition, their use in integrative medicine leads to a clear reduction of side effects in patients undergoing chemotherapy or radiotherapy. The literature reports a number of beneficial effects of using mushrooms as health supplements in patients affected by high-grade glioma. The effects of medicinal mushrooms on side effects in patients with brain cancer and a case study report are also described in this review.
First record of Tamarix macrocarpa (Tamaricaceae) for Europe
2017
AbstractTamarix macrocarpa, a species with distribution in Central and North Africa, in the countries bordering the Persian Gulf and in Central and western Asia is recorded for the first time for Europe. Pentamerous flowers and androecium diplostemonous characterize this small tree.
The genus Tamarix (Tamaricaceae) in Apulia (southern Italy)
2018
This survey is part of the floristic exploration activities on the Italian territory related to the identification of spontaneous and cultivated plants of the genus Tamarix L. A list of tamarisks from Apulia (southern Italy) is here reported together with ecological and distributive data. On the whole, 7 species and 1 variety were recorded in the Apulian region. T. arborea var. arborea is the species with the widest distribution in the Apulian territory. The presence of T. canariensis, T. dalmatica and T. gallica, previously indicated for Apulia by other authors, is currently not confirmed.
Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes)
2016
An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name …
Phytochemical-rich extracts of Helianthemum lippii possess antimicrobial, anticancer, and anti-biofilm activities
2022
Helianthemum lippii is a perennial shrubby plant growing in the sandy environments of Italy, Mediterranean countries of North Africa and Middle East. H. lippii is used in traditional medicine but there are very few reports referring to the phytochemical characterization, the ethnopharmacology, and the biological activity of H. lippii. The goal of this study was todetermine the phytochemical composition of different H. lippii extracts, cold (CME) and hot (HME) methanol, cold (CPEE) and hot (HPEE) petroleum ether, as well as to evaluate their anticancer and antimicrobial activities and biofilm formation reduction. Fifty-fours phytocompounds have been determined by HPLC-UV-ESI-QTOF-MS analysis…
Aphyllophoraceous wood-inhabiting fungi on Quercus spp. in Italy
2008
240 species representing 100 genera of aphyllophoraceous fungi growing on Quercus spp. in Italy are listed. Some species are considered rare or infrequent in Italy, e.g. Bulbillomyces farinosus, Dendrothele dryina, Fomitopsis iberica, F. spraguei, Hyphoderma incrustatum, Inonotus andersonii.
New insights on the occurrence and conservation status in Italy of Alessioporus ichnusanus (Boletaceae), an IUCN red listed mycorrhizal species
2020
The conservation status of Alessioporus ichnusanus is discussed considering new insights emerged from the IUCN global assessment. New locations were identified and Italy is confirmed as the center of distribution of this species. According to the IUCN categories and criteria, A. ichnusanus is assigned to the category Vulnerable C2a(i).
Medicinal mushrooms: Valuable biological resources of high exploitation potential
2017
Higher Basidiomycetes and Ascomycetes mushrooms possess various immunological and anticancer properties. They also offer important health benefits and exhibit a broad spectrum of pharmacological activities including antibacterial, antifungal, antiviral, cytotoxic, immunomodulating, anti-inflammatory, antioxidative, antiallergic, antidepressive, antihyperlipidemic, antidiabetic, digestive, hepatoprotective, neuroprotective, nephroprotective, osteoprotective, and hypotensive activities. This minireview summarizes the perspectives, recent advances, and major challenges of medicinal mushrooms with reference to their nutraceutical properties and dietary value, the production of mushroom biomass …
Forest nurseries and the National Recovery and Resilience Plan: the case of Sicily and Apulia (Italy)
2023
In Italy, the National Recovery and Resilience Plan (NRRP) foresees the planting of ca. 6.6 million trees to establish urban and peri-urban forests in 14 metropolitan cities. This ambitious project requires a significant number of native trees and shrubs, currently unavailable in Italian public and private nurseries. This survey analyzes the state of forest nurseries in two administrative regions of southern Italy, i.e. the “Filici” forest nursery (province of Agrigento, Sicily) and the Gargano Mountain Reclamation Consortium (province of Foggia, Apulia), to evaluate the adequacy of Sicilian and Apulian forest nurseries as potential sources of plant material to meet the requirements of the …
Plant genetic resources and traditional knowledge on medicinal use of wild shrub and herbaceous plant species in the Etna Regional Park (Eastern Sici…
2014
Ethnopharmacological relevance: This paper illustrates the results of a study carried out in the Etna Regional Park (Eastern Sicily, Italy) concerning the traditional knowledge on medicinal use of wild plant species. It specifies contains the results of a quantitative analysis carried out for the first time. A total of 71 wild species are used for medicinal purposes. Two species, Astracantha sicula (Biv.) Greuter and Trifolium phleoides Willd., are little known as medicinal in the Mediterranean area. Aim of the study: The main aim of the study was to understand to what extent current knowledge on the medicinal use of plants is still an element of the culture within the elderly population of…
Naturalistic hotspots along the Itinerarium Rosaliae (CW Sicily, Italy)
2018
The conservation, fruition and management of landscape and natural resources is one of the most important topic of the moment. Here we presented a study on naturalistic hotspots that can be found along the Itinerarium Rosaliae, a naturalistic and religious route in Sicily that crosses three natural reserves and one natural regional park connecting Mount Pellegrino with the Hermitage of Santo Stefano di Quisquina. On the whole 7 semi-natural woods, 13 monumental trees, 8 geosites, and 4 areas of high naturalistic interest were identified. This initiative can be of example for other territories where human and natural heritage can be connected for an organic network of fruition.
Fungal biodiversity and in situ conservation in Italy
2011
A remarkable increase in knowledge of fungal biodiversity in Italy has occurred in the last five years. The authors report up-to-date numbers of fungi (Basidiomycota and Ascomycota) by regions together with distributional and ecological data on hypogeous fungi. Specific case studies such as alpine fungi, orchid mycorrhizas symbionts, invasive species, and the use of macrofungi as food by red squirrels are analyzed. In situ conservation strategies carried out on target species and/or taxonomic groups are also indicated.
Mycochemicals in wild and cultivated mushrooms: nutrition and health
2021
AbstractThe mushrooms have contributed to the development of active ingredients of fundamental importance in the field of pharmaceutical chemistry as well as of important tools in human and animal health, nutrition, and functional food. This review considers studies on the beneficial effects of medicinal mushrooms on the nutrition and health of humans and farm animals. An overview of the chemical structure and composition of mycochemicals is presented in this review with particular reference to phenolic compounds, triterpenoids and sterols, fatty acids and lipids, polysaccharides, proteins, peptides, and lectins. The nutritional value and chemical composition of wild and cultivated mushroom…
A revision of Tamarix specimens (Tamaricaceae) kept in the BCN herbarium of Barcelona (Spain)
2018
The taxonomy of genus Tamarix L. is notoriously controversial and many taxa are still not or wrongly identified. A huge number of tamarisk specimens are kept in the most important herbaria of Spanish universities but many labels needs a deep nomenclatural revision. The Tamarix collection in Universitat de Barcelona (BCN) is composed by 158 samples, collected in different Comunidades Autónomas de España, and corresponding to 14 taxa.
Microbial safety of black summer truffle collected from Sicily and Umbria Regions, Italy
2021
Background: Tuber aestivum Vittad., known as black summer truffle, represents high-value food especially used as garnishment in nouvelle cuisine. The aim of this study was to investigate on the viable microbial populations associated with T. aestivum ascomata collected in different sites of Sicily and one locality of Umbria (Italy).
 Methods: The ripe ascomata of black summer truffles were collected from Central Italy. Cell densities of spoilage bacteria, fecal indicators, potential pathogens, yeasts, and molds were analyzed. Statistical analysis was conducted with XLSTAT software.
 Results: The microbiological counts of truffles ranged between 6.00 and 9.63 log Colony Forming Uni…
Calongea prieguensis (Pezizaceae), a rare hypogeous ascomycetes in Europe
2019
Calongea prieguensis is a rare hypogeous ascomycetes with fragmented distribution in Europe. The taxonomy, ecology and distribution of this species are reported in this short note. The new locality from northen Sicily widens the area of distribution of C. prieguensis in Europe.
Mushroom-Based Supplements in Italy: Let’s Open Pandora’s Box
2023
Mushrooms and derivates are well known to the scientific community for having different health benefits and exhibit a wide range of pharmacological activities, including lipid-lowering, antihypertensive, antidiabetic, antimicrobic, antiallergic, anti-inflammatory, anticancer, immunomodulating, neuroprotective and osteoprotective actions. In Europe, medical mushrooms are mainly marketed in the form of food supplements as single components or combined with other nutraceuticals. In this context, the first peculiarity that distinguishes it is the safety established through the “history of consumption” that characterizes that mushroom. However, the cultivation of medicinal mushrooms on a large s…
First morphological and molecular investigation of the mycobiota associated with Astragalus nebrodensis in its natural environment (Madonie mountains…
2023
Although Astragalus nebrodensis plays a fundamental ecological role, mycorrhizal fungi associated with this species have never been investigated in natural habitats. Our aim was to check the presence and occurrence of Arbuscular Mycorrhizal Fungi (AMF) in roots of A. nebrodensis in a natural habitat and to screen the fungal diversity in the surrounding soil, considering the positive influence of mycotrophic shrub species on soil microbiota. A morphological analysis was performed on A. nebrodensis roots samples from the Madonie mountains (Sicily, Italy), while high-throughput-sequencing was carried out in A. nebrodensis roots and in the associated soil. Observations of A. nebrodensis roots r…
More nature in the city
2020
According to projects and practices that the Italian botanists and ecologists are carrying out for bringing “more nature in the city”, new insights for a factual integration between ecological perspectives and more consolidated aesthetic and agronomic approaches to the sustainable planning and management of urban green areas are provided.
Diversity of macrofungi and exploitation of edible mushroom resources in the National Park “Appennino Lucano, Val D'Agri, Lagonegrese” (Italy)
2015
An investigation on the macrofungal diversity of the National Park “Appennino Lucano, Val D’Agri, Lagonegrese” (Basilicata, southern Italy) was carried out, together with an evaluation of wild edible mushrooms in agro-forest ecosystems and their possible exploitation as a new source of food and revenue in rural and under-developed areas of this region. An unpublished list of 249 mushroom taxa (229 Basidiomycota and 20 Ascomycota), mostly belonging to the genera Tricholoma, Tuber, Russula, Amanita, Boletus, Lactarius, Mycena, Agaricus, Clitocybe and Hygrophorus, growing in this important natural area is provided together with ecological characterization of the recorded specimens. Inonotus ob…
Medicinal Properties of Mediterranean Oyster Mushrooms: Species of Genus Pleurotus (Higher Basidiomycetes)
2017
The term “Mediterranean area,” applied in this chapter, refers to the definition reported in Med-Checklist and particularly to all countries bordering the Mediterranean Sea plus Portugal, Bulgaria, the Crimea (Ukraine), and Jordan. The “Mediterranean oyster mushrooms” is a geographically and ecologically well-defined group of Basidiomycetes. The medicinal properties of some widely investigated species such as Pleurotus ostreatus and P. eryngii are recognized worldwide, while in the case of some other Mediterranean Pleurotus taxa, there is still a lack of knowledge. A substantial increase in knowledge about the anticancer and antibacterial properties of the group of Pleurotus species growing…
IsBattarrea phalloidesreally an endangered species?
2020
Battarrea phalloides (Basidiomycota), a fungus included in many Red Lists worldwide, requires verification of its real conservation status. One of the main problems in the assessment of fungal spec...
Wild and cultivated mushrooms as a model of sustainable development
2013
The natural resources are currently overexploited and since 1992 the Conference of Rio de Janeiro has focused on sustainable development to safeguard our planet for future generations. The Fungi kingdom includes producers of goods and services for ecosystems and organisms widely used in the food industry. Besides, macrofungi are recognized as nontimber forest products and could be utilized as agents of environmental management through weed biocontrol and environmental improvement. Moreover, the cultivation of fungi, in particular truffles, can provide an important income in agroecosystems, especially in marginal areas, along with the development of new technologies to produce novel products…
Functional bread supplemented with Pleurotus eryngii powder: A potential new food for human health
2022
The purpose of this study was to develop functional breads with powdered Pleurotus eryngii. The breads were produced applying the traditional Italian style sourdough technology. P. eryngii powder was added to flour of tender wheat varieties (Grano Dei Miracoli, Inalettabile, Mentana, Gentilrosso, Ardito and a mix of Rieti, Verna, and Mentana) or semolina of durum wheat landrace (Saragolla) and subjected to sourdough fermentation. Sourdough inoculum was produced with selected strains of lactic acid bacteria (LAB) belonging to the species Levilactobacillus brevis, Weissella cibaria and Leuconostoc citreum. The addition of Pleurotus powdered (PP) (10% w/w) did not influence the fermentation pr…
Updated checklist of macromycetes of Tunisia
2020
A preliminary checklist of macromycetes has been previously published with reference to six governorates located in northern Tunisia. This paper provides an updated version of the inventory of macromycetes in Tunisia, which includes 268 species, of which seven are worldwide recognized as rare. The investigation was carried out from September 2015 to December 2018 in 13 governorates of the Tunisian territory. This updated checklist reports 145 new national species records (139 basidiomycetes and six ascomycetes) belonging to 57 genera and 13 families. Data related to distribution, ecology and preferential hosts of each recorded taxon are also provided.
Volatile organic compounds in wild fungi from Mediterranean forest ecosystems
2017
AbstractHead Space-Solid Phase Micro Extraction (HS-SPME) extractions and Gas Chromatography-Mass Spectrometry (GC-MS) analysis allowed the identification of 72 different compounds isolated from 7 different wild inedible fungi collected in Mediterranean forest ecosystems. The VOCs reported in this study, including a total of 5 esters, 17 alcohols, 14 aldehydes, 9 ketones, 18 terpenes and 9 other compounds, have been never characterized before for Tricholoma ustaloides, Hygrophorus cossus, Russula foetens and Mycena pura.
Macrofungi in Mediterranean maquis along seashore and altitudinal transects
2014
In semi-arid Mediterranean environments, fungal activity is fundamental for buffering biotic and abiotic stress to the plant and for sustaining a vegetation cover. Despite the important role that fungi play in habitats stability, mycological data from Mediterranean ecosystems are scarce and fragmentary. We investigated fungal diversity in several areas characterized by Mediterranean maquis, from continental Italy, Sicily, and Greece in order to contribute to the analysis of distribution, ecology, and diversity of macrofungi in evergreen sclerophyllous shrublands at different elevation and distance from the seashore across the Mediterranean Basin. Several fungal taxa that are remarkable due …
The Mineral Contents of Some Boletaceae Species from Sicily (Southern Italy)
2014
Abstract Data on the accumulation of metals in wild edible and inedible macrofungi of the Boletaceae family are discussed here and compared with data reported in literature from northern Italy and other European countries, as well as from China, Brazil, and Africa. The results show a significant difference in the values detected in Sicilian fungi compared to those reported in the literature.
Effects of Diets Supplemented with Medicinal Mushroom Myceliated Grains on Some Production, Health, and Oxidation Traits of Dairy Ewes
2019
The beneficial properties of mushrooms’ bioactive compounds indicate their potential for use as performance-enhancing natural additives for livestock animals. A study was undertaken to evaluate the effects of diets supplemented with mushroom myceliated grains (MMGs) fed to dairy ewes on intestinal parasite load, milk production, milk fatty acid (FA) composition, and cheese oxidative stability. During an 8-week experimental period, 21 lactating Valle del Belice ewes were divided into 3 groups named MMG20, MMG10, and MMG0. Ewes in each group were fed hay ad libitum and 1.3 kg/day/head of 1 of 3 concentrates with MMGs at 20% (MMG20), 10% (MMG10), or 0% (MMG0). The ewes fed MMG20 had comparable…
The genus Pleurotus in Italy
2015
On the basis of personal observations, herbarium specimens and, data reported in the literature the authors report morphological, ecological and distributive data on Pleurotus taxa from Italy. New descriptions are here provided based on the most distinctive-discriminating eco-morphological characters of twelve Pleurotus taxa.
In vitro antitumor effects of the cold-water extracts of Mediterranean species of genus Pleurotus (higher Basidiomycetes) on human colon cancer cells
2014
The aim of this study was to evaluate whether the cold-water extracts of Pleurotus eryngii var. ferulae (CWE-Pef) and Pleurotus nebrodensis (CWE-Pn), 2 of the most prized wild and cultivated edible mushrooms, can affect the tumor phenotype of human colon cancer HCT116 cells. Our results showed that treatment with CWE- Pef and CWE-Pn resulted in a significant inhibition of the viability of HCT116 cells and promoted apoptosis, as also demonstrated by the increase of Bax-to-Bcl-2 messenger RNA ratio. Moreover, we observed that both extracts were able to inhibit cell migration and to affect homotypic and heterotypic cell-cell adhesion. It also was found that treatment with CWE-Pef and CWE-Pn ne…
Leaf anatomy in Tamarix arborea var. arborea (Tamaricaceae)
2012
Previously unpublished data on the macro- and micro-morphological features of the leaf of Tamarix arborea var. arborea are provided. Clear differences in salt gland localization and type of venations were observed in the investigated species compared to other Tamarix species, thus emphasizing the taxonomic value of the leaf within this genus.
Coprinopsis strossmayeri agg. infrequent but easy to identify
2020
First record of Tamarix meyeri (Tamaricaceae) for western Europe
2012
Abstract Field investigations and herbaria reference work carried out in Italy and Spain allowed us to identify wild and cultivated plants of Tamarix meyeri, a new species from western Europe. This small tree is characterized by tetramerous, rarely pentamerous flowers and a paralophic disk.
Typification of the name Erodium soluntinum Tod. (Geraniaceae) and its taxonomic implications
2017
The present contribution is part of the ongoing work promoted by the Italian Botanical Society aimed at recognizing and typifying all the taxa described from Italy and their loci classici, in order to increase their systematic knowledge and promote further studies (Domina et al. 2012, Peruzzi et al. 2015, Brundu et al. 2017). One of these taxa is Erodium soluntinum Todaro (1869: 36), a species belonging to Geraniaceae and considered an Italian endemic (Conti et al. 2005, Peruzzi et al. 2014, 2015). This name, as far as we are aware, is not yet typified.
Synthetic cartography for mapping biodiversity in the Mediterranean region: Sicily as a case study
2018
This paper proposes a new hierarchical land classification system for the mapping of species distribution at national or regional scales. Our integrative framework incorporates two hierarchical levels inferred from historical, climatic, geomorphological and geological attributes. The feasibility of this proposal is based on the use of historical collections and literature data, as well as on its ability to combine old low-precision data with more recent records of higher resolution. The system is set up for vascular plants, but it can also be used for other taxonomic groups. Furthermore, it has the potential for application to the whole Mediterranean region because it is based on informatio…
Medicinal Mushrooms as Part of the "Third Mission" Activities of Univesities - A Science to Business Initiative Related to Mycotherapy
2021
In Italy, the National Agency for the Evaluation of the University System and Research (ANVUR) carries out a systematic evaluation of the "Third Mission" activities of universities and research bodies. In this perspective, universities already engaged in research on medicinal mushrooms and on their potential applications in the industrial sector set the frame for collaboration with large, well-reputed private companies. In Italy, one of the major problems of mycotherapy is related to lack of certification and the dubious origin/identity of mushroom extracts used by the industry. Hence, products deriving from medicinal mushrooms that are in trade do not often meet the required quality criter…
First record of Capnobotrys dingleyae (Metacapnodiaceae) on Taxus baccata for southern Europe
2017
Field investigations carried out in a mixed forest of Fagus sylvatica and Taxus baccata in the Nebrodi Natural Park (Sicily, southern Italy) allowed us to identify a very rare lignicolous ascomycete Capnobotrys dingleyae, a new species for southern Europe.
New national and regional bryophyte records, 53
2017
WOS: 000423214200007
Ecology, Phylogeny, and Potential Nutritional and Medicinal Value of a Rare White “Maitake” Collected in a Mediterranean Forest
2020
Albino Grifola frondosa (Dicks.) Gray &ldquo
A contribution to the knowledge of myxomycetes diversity in volcanic islands
2015
A list of myxomycetes collected in Pantelleria, a volcanic island located 110 km southwest of the island of Sicily ( Italy), is presented with data on distribution. Forty-nine taxa were identified, 38 of which are new for Sicily. The myxomycete diversity of Pantelleria was also compared with that of other volcanic islands located in the Atlantic and Pacific oceans. A list of myxomycetes collected in Pantelleria, a volcanic island located 110km southwest of the island of Sicily (Italy), is presented with data on distribution. Forty-nine taxa were identified, 38 of which are new for Sicily. The myxomycete diversity of Pantelleria was also compared with that of other volcanic islands located i…
Antibacterial Activity of Desert Truffles from Saudi Arabia Against Staphylococcus aureus and Pseudomonas aeruginosa
2017
Abstract Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial, and immune-stimulating properties. Traditional studies of epigeous higher Basidiomycetes have recently been joined by studies of hypogeous fungi and, in particular, of so-called desert truffles. With the aim to obtain novel agents against bacteria of clinical importance, we focused on the edible desert truffle mushrooms Tirmania pinoyi, Terfezia claveryi, and Picoa juniperi as sources of new antimicrobial agents. In particular, we investigated the in vitro antibacterial activity of acid-soluble protein extracts (aqueous extracts) of these 3 species against the Gram-pos…
JNK pathway and heat shock response mediate the survival of C26 colon carcinoma bearing mice fed with the mushroom Pleurotus eryngii var. eryngii wit…
2021
In the last few years, there has been emerging interest in developing treatments against human diseases using natural bioactive content. Here, the powder of the edible mushroom Pleurotus eryngii var. eryngii was mixed with the normal diet of mice bearing C26 colon carcinoma. Interestingly, it was evidenced by a significant increase in the survival rate of C26 tumor-bearing mice accompanied by a significant increase in Hsp90 and Hsp27 protein levels in the tumors. These data were paralleled by a decrease in Hsp60 levels. The mushroom introduced in the diet induced the inhibition of the transcription of the pro-inflammatory cytokines IL-6 and IL-1 exerting an anti-inflammatory action. The eff…
Germplasm of medicinal and aromatic plant species in the Parco della Favorita in Palermo city (Sicily, Italy)
2017
Despite high urbanization, the city of Palermo (Sicily, Italy) has a good level of plant biodiversity. The Parco della Favorita is the largest green space in the city. It covers an area of 400 ha and is the green lung of the city. The Parco della Favorita is home to many wild species of medicinal and aromatic plants (MAPs). This study aims to promote the Favorita Park as an urban green area to be used for educational purposes to raise awareness for the medicinal and food uses of MAPs. Nineteen plant species belonging to fifteen botanical families were identified. The most representative plant species were Foeniculum vulgare, Laurus nobilis, Capparis spinosa and Malva sylvetsris. Some of the…
The Potential Role of Medicinal Mushrooms in the Prevention and Treatment of Gynecological Cancers: A Review
2019
A review of scientific information about the potential role of medicinal mushrooms in the prevention and treatment of gynecological cancers, human immunodeficiency virus, and human papillomavirus infections is reported here. The results of in vivo and in vitro experiments on 16 different species of Basidiomycetes and three Ascomycetes, which possess chemopreventive potential and are effective in clinical application in combination with chemotherapy, are also discussed. Medicinal mushroom extracts confirm an evident efficacy on the reduction of tumor cell proliferation and side effects in patients with gynecological tumors who are undergoing chemotherapy treatments. This review, the first on…
Tamarix arborea var. arborea and Tamarix parviflora: Two species valued for their adaptability to stress conditions.
2016
The choice of stress resistant and highly adaptable species is a fundamental step for landscaping and ornamental purposes in arid and coastal environments such as those in the Mediterranean basin. The genus Tamarix L. includes about 90 species with a high endurance of adversity. We investigated the water relations and photosynthetic response of Tamarix arborea (Sieb. ex Ehrenb.) Bge. var. arborea and T. parviflora DC. growing in an urban environment. Both species showed no evidence of drought or salt stress in summer, and appeared to follow two strategies with T. arborea var. arborea investing in high carbon gain at the beginning of the summer, and then reducing photosynthetic activity at t…
Antibacterial activity of Mediterranean Oyster mushrooms, species of genus Pleurotus (higher Basidiomycetes).
2013
Extracts of the Mediterranean culinary-medicinal Oyster mushrooms Pleurotus eryngii var. eryngii, P. eryngii var. ferulae, P. eryngii var. elaeoselini, and P. nebrodensis were tested for their in vitro growth inhibitory activity against a group of bacterial reference strains of medical relevance: Staphylococcus aureus ATCC 25923, S. epidermidis RP62A, Pseudomonas aeruginosa ATCC 15442, and Escherichia coli ATCC10536. All of the Pleurotus species analyzed inhibited the tested microorganisms in varying degrees. The data included in this paper for P. nebrodensis and P. eryngii var. elaeoselinii are new reports.
Two Rare Northern Entoloma Species Observed in Sicily under Exceptionally Cold Weather Conditions
2011
The biology and ecology of manyEntolomaspecies is still poorly known as well as their geographical distribution. In Italy, there are no studies on the influence of weather on fungal abundance and richness and our knowledge on the ecology and distribution ofEntolomaspecies needs to be improved. The discovery of twoEntolomaspecies in Sicily (southern Italy), reported in the literature as belonging to the habitat of north European countries, was the basis leading to the assumption that anomalous climatic conditions could stimulate the growth of northern entolomas in the southernmost Mediterranean regions. The results of this study show that the presence of northernEntolomaspecies in Sicily is …
Ex situ conservation and exploitation of fungi in Italy
2011
Abstract The kingdom Fungi comprises one of the most diverse groups of living organisms. They are numerous, ubiquitous and undertake many roles both independently and in association with other organisms. Fungi display a wide diversity of forms also mirrored by functional diversity and play such a dominant role in human society that they are arguably biotechnologically the most important group of organisms. Ex situ conservation of fungi, not only guarantees correct management and conservation of biodiversity, but also its exploitation in different fields. This article describes the major biological resource centres dealing with fungi in Italy and gives several examples of fungal exploitation…
Untargeted Metabolomics Used to Describe the Chemical Composition, Antioxidant and Antimicrobial Effects of Extracts from Pleurotus spp. Mycelium Gro…
2022
Pleurotus species isolated in vitro were studied to determine the effect of different media on their production of secondary metabolites, antimicrobial, and antioxidant activity. The different metabolites among Pleurotus samples covered a total of 58 pathways. Comparisons were made between the metabolic profiles of Pleurotus spp. mycelia grown in two substrates: Potato-dextrose-agar-PDA, used as control (S1), and PDA enriched with 0.5 % of wheat straw (S2). The main finding was that the metabolic pathways are strongly influenced by the chemical composition of the growth substrate. The antibacterial effects were particularly evident against Escherichia coli, whereas Arthroderma curreyi (CCF …
Macrofungi as ecosystem resources: Conservation versus exploitation
2013
Fungi are organisms of significant importance not only for the crucial roles they undertake in nature but also for many human activities that are strictly dependent on them. Indeed, fungi possess fundamental positions in ecosystems functioning including nutrient cycles and wood decomposition. As concerns human-related activities, edible and non-edible mushrooms are also involved and/or exploited in forestry, pharmaceutical industry and food production; hence, nowadays they represent a major economic source worldwide. In order to maintain and improve their strategic importance, several conservation strategies, such as habitat preservation, are needed. This article reports several contributio…
Cultivated mushrooms: importance of a multipurpose crop, with special focus on Italian fungiculture
2020
Fungi, organisms of high nutritional value with significant bioactive compound content, are considered to be nutraceuticals, mycotherapeutics, cosmeceuticals and useful for the production of functional foods. Their cultivation allows the sustainable management of agro-industrial wastes and generates good income with low inputs, constituting a good opportunity for the development of economically depressed rural areas. There are also many possible uses for the spent substrate in various sectors. provide an overview of the nutritional value of mushrooms and the cultivation of edible and medicinal mushrooms cultivation and uses in Italy.
Taxonomic notes and critical discussion on the status of Hydnum notarisii (Basidiomycota) through the evaluation of Giuseppe Inzenga's original study…
2016
The current taxonomic status of Hydnum notarisii Inzenga is here critically analyzed on the basis of Giuseppe Inzenga’s original description and of the specimens kept in his private herbarium hosted in the Istituto Agrario Castelnuovo (Palermo, Italy) and in the Herbarium of Museum of Evolution, Uppsala University, Sweden (UPS). The detailed morphological study of the original dried material through the use of compound optical and scanning electron microscopy demonstrated that this particular fungus possesses very similar features with Hericium erinaceus (Bull.) Pers.
Microbiological, chemical and sensory aspects of bread supplemented with different percentages of the culinary mushroom Pleurotus eryngii in powder f…
2018
Pleurotus eryngii (DC.) Quél. powder was used in bread production. Three dough trials (0, 5 and 10% of mushroom) were obtained with commercial baker's yeast. P. eryngii powder was first tested against several yeast species; 10% P. eryngii trial was characterised by the highest pH and total titratable acidity. P. eryngii did not influence negatively the fermentation process, since all trials reached yeast levels of 10 8 CFU g −1 . Mushroom powder decreased bread height and softness, increased crust redness and crumb void fraction and cell density and, although the breads were scored diverse, the overall assessment was comparable. The final breads provided higher concentrations of thiamin, ri…
Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom
2015
In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.
Two uncommon fungal species from Italy
2019
Mediterranean forests continue to be an inexhaustible reservoir of fungi of considerable ecological and biogeographical interest. In this paper two rare and/or infrequent species are reported. Boletopsis grisea is a threatened species in Europe while H. subtortum is infrequent.
The 9th International Medicinal Mushrooms Conference (IMMC9), September 24–28, 2017, Palermo, Italy
2018
A Conference Report of the 9th International Medicinal Mushrooms Conference, Palermo 24-28 September 2018
Current Research on Medicinal Mushrooms in Italy
2019
Historical data and current research in Italy reveal the permanent interest of people and scientists toward the importance of fungi as functional food and medicine. This chapter reports the main studies on medicinal mushrooms carried out by Italian researchers on the antibacterial activity, the characterization of β-glucans content, antitumor activity, Alzheimer’s disease, characterization of bioactive compounds, antimicrobial activity, dietary supplementation, chemical contents, and animal health. Currently, in vitro experiments are prevalent with respect to clinical trials on human and animals.
Pisolithus albus, a new record for Italy
2018
The results of macroscopic and microscopic observations have highlighted the presence of P. albus also in Italy. The distribution of this species in the Italian territory seems much wider than previously realised and most of the herbarium samples previously identified as P. arhizus should probably be re-analyzed using morphological, microscopic and molecular criteria.
Pleurotus opuntiae revisited e An insight to the phylogeny of dimitic Pleurotus species with emphasis on the P. djamor complex
2018
Abstract The name Pleurotus opuntiae is indiscriminately used for describing mushrooms with white to off-white to white-grey pilei with short or absent stipe and dimitic hyphal system, which grow on plants of the genera Opuntia, Yucca, Agave, Phytolacca etc. However, the outcome of the present study evidences that this name should be reserved for specimens deriving from the Mediterranean area only; an epitype originating from Italy on Opuntia ficus-indica is designated. Pertinent material was sequenced by using the internal transcribed spacer region (ITS) and found to be phylogenetically related to P. djamor from Kenya and Nigeria, while members of the P. djamor complex from other continent…
Effects of Pleurotus eryngii var. eryngii in "in vitro" and "in vivo" cancerogenetic models
2018
Heat shock proteins (Hsps) are highly expressed in a variety of cancer types contributing to tumor cell propagation and protection against apoptosis [1]. The current anti-cancer therapy is not always target specific and often is associated with complications for patients, Therefore new effective, specific and less toxic therapeutic approaches are needed. Medicinal mushrooms have emerged as wonderful source of nutraceuticals, anti-oxidants, anticancer, prebiotic, anti-inflammatory, cardiovascular, anti-microbial, and anti-diabetic. The ongoing research projects are aimed to promote mushrooms as new generation ‘‘biotherapeutics’’[2]. The aim of this study was to evaluate whether the cold-wate…
First report of Pleurotus fuscosquamulosus (Pleurotaceae, Basidiomycota) in Italy naturally occurring on new tropical hosts
2019
Basidiomata of a mushroom macroscopically recognised as Pleurotus cystidosus sensu latu were collected on the trunks of three tropical ornamental trees such as Broussonetia papyrifera, Yucca elephantipes, and Paulownia tomentosa in the Parco d’Orleans, an urban park in the town of Palermo (Sicily, Italy). All the plants showed cavities and white rot symptoms at the base of the trunks. Macro- and microscopic observations on both collected basidiomata and isolated colonies, as well as molecular analysis, allowed identifying the collected basidiomata as Pleurotus fuscosquamulosus and its anamorph as Antromycopsis fuscosquamulosus. These species belong to the subgenus Coremiopleurotus that incl…
Potential Activity of Albino Grifola frondosa Mushroom Extract against Biofilm of Meticillin-Resistant Staphylococcus aureus
2021
Mushroom extracts are a rich source of natural compounds with antimicrobial properties, which are able to prevent, to some extent, the growth of foodborne pathogens. The aim of this study was to investigate the potential of extracts from albino Grifola frondosa (GF), commonly known as maitake, to inhibit the growth of some bacteria and the biofilm production by Staphylococcus aureus. We obtained not only a significant reduction of OD score between biofilm and biofilm plus albino G. frondosa extract group, but also a reduction of category of biofilm. In addition, we observed a significant presence of isolates with strong category for the biofilm group and a significant presence of isolates w…
Osservazioni morfoanatomiche su differenti popolazioni di Anthemis cupaniana Tod. ex Lojac. (Asteraceae)
2004
The genus Pleurotus in Italy and the Sicilian taxa
2013
This chapter provides a brief description of species diversity and distribution of taxa belonging to the genus Pleurotus for each Italian region. For taxa that grow on the Sicilian territory and belong to the so-called “Pleurotus eryngii species-complex” ecological data are also reported.
Antibacterial activity of Pleurotus species
2013
Basidiomycetes express promising antitumor, immune modulating, cardiovascular and hypercholesterolemia, antiviral, antibacterial and antiparasitic effects (Wasser & Weis, 1999; Reshetnikov et al., 2001; Wasser, 2002, Didukh et al., 2003). They are also well known for their safety and efficacy as functional foods and dietary supplements (Wasser & Akavia, 2008). The antibacterial and antiviral value of different genera of Basidiomycetes has been tested by different authors (Benedict & Brady, 1972; Donnelly et al., 1986; Gao et al., 2003;). In particular the antibacterial and antiparasitic therapeutic effects were investigated in the genera Flammulina P. Karst, Fomes (Fr.) Fr., Ganoderma P. Ka…
I pleuroti delle ombrellifere in Sicilia
2012
Gli Autori dopo avere evidenziato le problematiche tassonomiche del genere Pleurotus con particolare riferimento alle specie che fruttificano sui residui radicali delle ombrellifere entrano nel merito del caso di studio di Plerutous nebrodensis, specie rara ed a rischio di estinzione.
Pisolithus albus (Sclerodermataceae), a new record for Tunisia
2015
Pisolithus albus was recently collected for the first time in Tunisia. This ectomycorrhizal fungus is found associated with Eucalyptus occidentalis, a new symbiotic relationship, in the urban area of Tunis. The new record of this fungus on this tree permit to expand our knowledge on the ecology and distribution of P. albus in Tunisia. The finding is also important since this fungal symbiont has great potential in forestation efforts. Data on the morphology, molecular identification, distribution and, ecology for P. albus in Tunisia are presented for the first time.
INVESTIGATION ON OLD-GROWTH FORESTS OF SICILY: PRELIMINARY RESULTS
2014
Old-growth forests are natural forests that have developed over a long period of time, without experiencing severe, stand-replacing disturbance a fire, windstorm, or logging. According to UNEP/CBD/SBSTTA definition, an old-growth forest is a primary or a secondary forest which has achieved an age at which structure and species normally associated with old primary forests of that type have sufficiently accumulated to act as a forest ecosystem distinct from any younger age class. In a thematic contribution to the National Biodiversity Strategy, the authors report the following definition of Italian old-growth forests: Forest in which human disturbance is absent or negligible, and in which nat…
THE SAF HERBARIUM AT THE DEPARTMENT OF AGRICULTURAL AND FOREST SCIENCE (UNIVERSITY OF PALERMO)
2014
In the wide scenario of herbaria housed in the Italian Universities there are very few examples of structures mainly devoted to forest sciences and fungi in forest ecosystems. The “Regio Istituto Superiore Forestale di Vallombrosa” (Tuscany), established in 1869, was the first example of a structure that housed an herbarium with exsiccata of forest trees. In Italy, the southernmost laurea degree course in “Environmental and Forest Sciences” concern the Department of Agricultural and Forest Sciences in the University of Palermo (Sicily). Two herbaria (CAT and PAL) are currently present in Sicily with the following specialties: a) Vascular plants, bryophytes, and algae of Mediterranean area, …
The check-list of fungi in Sicily (southern Italy): current survey status
2011
A number of checklists are currently available in several continents, European and extra European countries (Holland, Switzerland, France, United Kingdom, North America, Argentina, Brazil, Uruguay, Venezuela, Bulgaria, Greece, Italy, Norway, Poland, Portugal, Spain, Romania, Russia, Africa, Iran, Oman, Turkey, Asia). The checklists are modern tools for evaluation of fungal biodiversity and precious documents to obtain ecological data and information for management and exploitation of protected areas, agro- and forest ecosystems. A checklist of Sicilian fungi was edited by Venturella (1991), followed, in 2009, by a new report (Gargano et al., 2009). At that time the number of macrofungi from…
A protocol to evaluate the antioxidant capacity by crocin bleaching assay in Pleurotus edible mushrooms
2008
Unpublished data on the chemical composition and nutritional value of Pleurotus mushrooms, growing on Umbelliferous plants (Apiaceae), are here reported. Cultivated basidiomata of four different Pleurotus taxa were analyzed in order to evaluate the composition in lipids, sugars, nitrogen, water, vitamins, ashes, and energetic values. The results showed that Pleurotus mushrooms are suitable in every type of diet thanks to their low caloric content, gastronomic value, vitamins, and mineral salt contents. The presence of a high content of vitamin B12 and riboflavin in Pleurotus nebrodensis is noteworthy.
Building the jigsaw puzzle of the critically endangered Pleurotus nebrodensis: historical collection sites and an emended description
2011
Historical collection sites of the critically endangered Pleurotus nebrodensis were retraced in Sicily (southern Italy) using recently rediscovered documents and through interviews with local people. These localities were visited in 2009 and checked for the presence of this rare mushroom, confirming a continuing decline in fruiting. An emended description of the taxon is provided based on observations on abundant recently collected material. The need for more incisive action to safeguard this valuable mushroom by the University of Palermo, Regional Park of Madonie Administration and policy makers is emphasized.
Australohydnum dregeanum new to Italy
2014
We report on the first finding in Italy (and the third in Europe) of Australohydnum dregeanum. A detailed description of the macro- and micromorphological features, the ecological data, and some taxonomic remarks concerning this taxon are provided. The bluish tint in the centre of the hymenophoral surface and the non-cystidiform aspect of the marginal hyphae are previously undescribed characters.
Preliminary observation on antioxidant capacity in Pleurotus eryngii species-complex
2008
I funghi nello sviluppo sostenibile: il caso dei noccioleti dei Nebrodi (Sicilia nord-orientale)
2007
Nuove stazioni di Tamarix arborea var. arborea e T. chinensis (Tamaricaceae) in Sicilia
2009
Tamarix arborea (Sieb. Ex Ehrenb.) Bge. var. arborea e T. chinensis Lour. sono due specie ampiamente diffuse sul territorio siciliano dove, oltre ad essere coltivate a scopo ornamentale, da alcuni anni manifestano una chiara tendenza alla spontaneizzazione. Nell’ambito dell’esplorazione floristica del territorio siciliano, finalizzato ad una più esauriente caratterizzazione del genere Tamarix L. in Italia (1, 2, 3), sono state individuate nuove stazioni di Tamarix arborea var. arborea e T. chinensis. Tamarix arborea var. arborea è diffusamente coltivata a San Vito Lo Capo (Trapani) come specie ornamentale, mentre allo stato spontaneo è stata raccolta all’interno della Riserva Naturale Orien…
Nuovi casi di spontaneizzazione di Tamarix parviflora DC. in Sicilia
2008
First Report of Agaricus aridicola in Saudi Arabia and Ecological Notes on Agaricus bisporus
2015
Agaricus aridicola is reported for the first time from Saudi Arabia while Agaricus bisporus is a new record for Northern region of Saudi Arabia. This study includes notes on taxonomy, ecology and distribution of both the species. It was also reported that the habitat of A. aridicola and A. bisporus are characterized by calcareous sandy soil, poor in organic matter, with presence of little amount of salinity.
Cultivation and nutritional value of Pleurotus nebrodensis
2013
A detailed report on Pleurotus nebrodensis cultivation methodologies, production costs, main pests and diseases and their control techniques is presented, together with information about the nutritional value and medicinal properties of the mushroom.
Antimicrobial activity of the extracts of Terfezia claveryi and Tirmania pinoyi against gram-positive and gram-negative bacteria causal agent of dise…
2017
Tomato diseases caused by virus, bacteria and fungi have been reported worldwide and caused considerable economic losses. Among all diseases, attention is paid to those caused by bacteria. In this study, the extracts of two “desert truffles” Terfezia claveryi and Tirmania pinoyi were tested against six bacterial species, causal agent of economically important tomato diseases: Pseudomonas corrugata, P. mediterranea, P. syringae pv. tomato Pectobacterium carotovorum subsp. carotovorum, Xanthomonas vesicatoria and Clavibacter michiganensis subsp. michiganansis. The extracts from both fungal species, evaluated by agar well diffusion method, showed an antimicrobial activity against all the teste…
I funghi dell'Isola del Giglio (Arcipelago Toscano): primo contributo
2010
The ecological and distributive data on macromycetes of Isola del Giglio (Tuscany Archipelago, ltaly), published in 1900 by Stefano Sommier; are integrated by new data on forty-live macromycetes. The recorded taxa are new for the island with the exception of seven species previously reported by Sommier.
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Truffle cultivation in Sicily: preliminary results
2008
Definizione di un protocollo per la caratterizzazione morfologica e molecolare del genere Daldinia Ces. & De Not. (Ascomycota) in Sicilia
2009
La possibilità di chiarire la tassonomia di alcuni complessi di specie come nel caso di Daldinia Ces. De Not. (1) per mezzo di indagini sia morfologiche che molecolari, permette un’esatta definizione dei taxa sulla base delle loro caratteristiche biologiche ed ecologiche. In un precedente studio (2) , effettuato sulla base dei caratteri teleomorfici ed anamorfici, sono stati descritti due taxa nuovi per la Scienza provenienti dal territorio siciliano: Daldinia martinii M. Stadler, Venturella & Wollweber e D. raimundi M. Stadler, Venturella & Wollweber. In questo contributo le stesse entità ed altri campioni di Daldinia di provenienza siciliana sono state analizzate con tecnologie differenti…
Impianto di una tartufaia sulle Madonie (Sicilia settentrionale)
2007
Contribution to the knowledge of Inonotus baumii in Thailand
2015
Inonotus baumii in Thailand is reported on three new host-plants: Acacia tomentosa, Shorea robusta, and S. siamensis. A key for the identification of Inonotus species in Thailand accompanies notes on the taxonomy of I. baumii.
Tassonomia, ecologia e distribuzione di Trichophaea abundans (Pyronemataceae) in Sicilia
2010
Historical remarks, orginal description and last advances on Pleurotus nebrodensis
2013
Giuseppe Inzenga, the scientist who first described Pleurotus nebrodensis, was one of the major mycologists of the second half of the 19th century. This chapter describes the main biographical aspects of the life of Inzenga and its contribution to science with particular reference to mycology. The chapter also includes notes on the social and academic context of the mid-1800s, which led Inzenga to the original description of P. nebrodensis, the analysis of the critical aspects of nomenclature and the logical path that led us to the recent designation of a P. nebrodensis epitype. An updated description of the taxon and the discovery of the loci classici of P. nebrodensis collections is also …
Nuovi ospiti di Inonotus tamaricis (Hymenochaetaceae) in Sicilia
2010
L’autore segnala T. arborea var. arborea, T. africana var. fluminensis e T. rosea quali nuovi ospiti di Inonotus tamaricis, agente di carie bianca. Si tratta di tamerici coltivate e spontanee, ampiamente diffuse nel territorio, che vegetano in condizioni precarie e di stress principalmente a causa di interventi di potatura poco razionali e del forte inquinamento.
A list of macromycetes from Calabria (southern Italy)
2016
On the basis of literature data and personal observation, a list of 338 species (319 Basidiomycetes, 18 Ascomycetes and 1 Zygomycetes) belonging to 156 genera included in 70 families is here reported for Calabria. Comparing the literature data with our records we confirmed the presence of 281 species while 57 are new for Calabria.
ECOLOGICAL FEATURES OF MACROMYCETES IN EUCALYPTUS REFORESTATIONS IN SICILY (SOUTHERN ITALY)
2009
The objective of this work was to compare and estimate the ecological features of 192 macromycetes, including nine hypogeous and three semi-hypogeous fungi, collected in Sicilian areas reforested with Eucalyptus. The number of mycorrhizal fungi turned out to be only 22 % of the taxa recorded so far from other areas, and this underlines the difficulties of eucalyptus trees in adapting to the pedological and climatic conditions of Sicily.
Taxonomic identity, geographic distribution and commercial exploitation of the culinary-medicinal mushroom Pleurotus nebrodensis
This work provides an updated overview of an investigation carried out in Europe and elsewhere on the culinary-medicinal mushroom Pleurotus nebrodensis. In particular, the taxonomic identitiy of P. nebrodensis and other related oyster mushrooms with entirely white to cream basidiomata that grow on different plants of the family Apiaceae, is clarified. The differences in the cultivation techniques, the quality of product sold and the sales price in Europe and Asia are also highlighted. Taking also into consideration the importance of P. nebrodensis from the medicinal point of view, it appears appropriate to proceed with a verification of the commercial strains currently available in the inte…
Market outlook, production chain and technological innovation for Pleurotus nebrodensis mushrooms
2013
This chapter provides a report of a marketing investigation performed in synergy with private companies in order to activate a production chain for the cultivation and trade of Pleurotus nebrodensis. A recent experience of technological innovation carried out in a farm of the Madonie (N. Sicily) territory is also presented. Notes on the status of Critically Endangered species and pertinent legislation are also provided.
IDENTIFICATION AND SUSTAINABLE EXPLOITATION OF WILD EDIBLE MUSHROOMS IN RURAL AREAS (“MYCOTICON”, LDV-TOI PROJECT): DEVELOPMENT OF AN INNOVATIVE TRAI…
2013
In Mediterranean and in southeast Europe the activities of a significant part of the population are traditionally linked with agriculture, forestry and animal husbandry. However, many rural communities are experiencing serious difficulties associated with low income per person and poor employment prospects combined with increased demographic decline. Alternative activities such as the collection and trading of wild edible mushrooms as well as the cultivation of choice species could contribute at providing valuable solutions both in financial and environmental terms. The total number of fungal species which are considered having edible and/or medicinal value is over 2300 [1]. Most of them fo…
Up-to-date distribution, ecology and cultivation of Pleurotus eryngii (DC.) Quél. var. thapsiae Venturella, Zervakis & Saitta in Sicily
2012
Venturella et al. [1] described a new taxon named Pleurotus eryngii (DC.) Quél. var. thapsiae Venturella, Zervakis & Saitta (Madonie Mts) on Thapsia garganica L. and provided ecological data on the locus classicus. P. eryngii var. thapsiae was reported on pastures evolved, from 1000 to 1500 m a.s.l., on limestone and is characterized by a double period of fructification (autumn and spring). P. eryngii var. thapsiae is a choice wild edible mushroom belonging to a special group of Pleurotus species which appear in nature in close association with Apiaceae plants. As part of the project's census of fungi in Sicily two new localities of growth were localized in the Natural Reserves of Capo Gall…
Verifica dei luoghi storici di raccolta di Pleurotus nebrodensis (Basidiomycota)ai fini di una valutazione dello stato del popolamento
2009
Nel 1902, Ferdinando Alfonso Spagna, direttore dell’Istituto Agrario Castelnuovo e redattore dei Nuovi Annali di Agricoltura Siciliana, è autore di una pubblicazione dal titolo “Dei funghi velenosi” (1) nella quale include un “elenco minuzioso dei funghi mangerecci più comuni” al fine di fornire indicazioni utili ai cercatori di funghi e per evitare i frequenti avvelenamenti che, a quel tempo, avevano causato numerose vittime in varie regioni d’Italia. Alfonso Spagna, tra le specie eduli e di buone proprietà organolettiche, segnala Pleurotus nebrodensis [sub: Agaricus nebrodensis Inz.], “fungo di eccellenti qualità”, noto localmente con il nome di “fungo di basilisco”. A differenza di Giuse…
The cultivation of Pleurotus and Lentinus mushrooms in tropical and subtropical areas: an overview
2010
The cultivation of edible mushrooms dates back a long time (CHANG & QUIMIO, 1982). The oyster mushrooms [Pleurotus (Fr.) P. Kumm.] are among the most popular edible mushrooms, and their cultivation is practiced throughout the world (KONG, 2004). P. ostreatus (Jacq.) P. Kumm. is the most widely-cultivated Pleurotus species for which many commercial strains have been developed. Other Pleurotus spp., i.e. P. cystidiosus O.K. Mill., P. djamor (Rumph. ex Fr.) Boedijn and P. pulmomarius (Fr.) Quél., are also exploited in both tropical and subtropical regions. In addition, Lentinus tuber-regium (Fr.) Fr., a common mushroom species in the southern part of Nigeria, is being studied and cultivated fo…
Lo stato dell'arte della ricerca su Pleurotus nebrodensis in Sicilia
2010
Sulla presenza di alcuni interessanti funghi ipogei e semi-ipogei in Sicilia
2009
In questo contributo vengono riportati i dati ecologici e distributivi relativi a Fischerula macrospora, Schenella simplex, Schenella pityophilus, Setchelliogaster tenuipes, Sclerogaster compactus e Gymnomyces xanthosporus. Per S. tenuipes var. rheophyllus vengono anche messe in evidenza alcune problematiche di carattere tassonomico.
Mycochemical investigation of Pleurotus eryngii var. eryngii
2017
The mycochemical composition and structural characterization of the whole aqueous and methanolic extracts from Pleurotus eryngii var. eryngii are investigated. Two water-soluble glucans were obtained from the fruiting bodies by hot water extraction, ethanol precipitation, dialysis and Sephadex G-200 gel filtration. On the basis of total hydrolysis, methylation analysis, and NMR studies (1H, 13C, DQF-COSY, TOCSY, HSQC and HMBC) two fractions PEPS-1 and PEPS-2 were characterized and the structure of the repeating unit of the glucan were determined as linear (1→6)--glucan and (1→6)--glucan, respectively. The methanolic extract of Pleurotus eryngii var. eryngii was also investigated and a com…
PROBLEMATICHE FITOPATOLOGICHE DEGLI ALBERI MONUMENTALI
2016
La fase di senescenza, lo stress e/o gli stati di sofferenza fisiologica degli alberi monumentali sono tra le principali cause dell’insediamento dei “patogeni di debolezza” o “opportunistici”, di difficile monitoraggio in quanto presentano una lunga fase asintomatica all’interno dei tessuti delle piante (Anselmi et al., 1999). Biscogniauxia mediterranea (De Not.) Kuntze (Xylariaceae) è un patogeno di debolezza ad habitus endofitico, polifago, che si riscontra frequentemente su piante deperenti o morte di molte specie del genere Quercus L. (Henriques et al. 2014). Un altro “patogeno di debolezza”, che si riscontra frequentemente su alberi senescenti, è Botryosphaeria stevensii Shoemaker (Bot…
Contributo alla conoscenza del genere Tamarix L. nell'Isola del Giglio (Arcipelago Toscano)
2009
Gli Autori, sulla base di una revisione dei campioni d'erbario depositati presso l'Università di Firenza e di personali raccolte, forniscono un contributo alla conoscenza delle tamerici dell'Isola del Giglio e propongono una chiave di identificazione dei taxa censiti.
Gli effetti dei trattamenti selvicolturali sulla dinamica delle cenosi fungine
2008
Gli ecosistemi forestali della Sicilia sono caratterizzati da un elevato livello di diversità. In particolare i funghi lignicoli, patogeni e saprofiti, sono numericamente ben rappresentati ed esprimono una diversità funzionale colonizzando varie tipologie di materiale legnoso. Per le ricerche effettuate all’interno degli ecosistemi forestali, naturali ed artificiali, si è fatto riferimento alla metodologia adottata a livello nazionale dal Gruppo di Interesse Scientifico per la Micologia della Società Botanica Italiana. In questo contributo la diversità dei funghi lignicoli viene messa in relazione con la forma di governo e di gestione selvicolturale. Viene inoltre sottolineata l’influenza d…
In vitro antitumor effects of the cold-water extracts of Pleurotus eryngii var ferulae and Pleurotus nebrodensis on human colon cancer cells
2013
For centuries, mushrooms have been used as folk medicines especially in Asian countries where their medicinal properties are well known. On the basis of numerous experimental evidences collected in the last decades, the immunomodulatory and anti-neoplastic properties of substances extracted from various species belonging to genera of edible mushrooms [Agaricus L., Auricularia Bull. ex Juss., Ganoderma P. Karst., Grifola Gray, Lentinus Fr., Schizophyllum Fr., Tremella Dill ex L., etc.] are extensively recognized also at scientific levels. Several works have demonstrate that anti-cancer property of these molecules is due to their ability to enhance immune system activity and/or to act directl…
Confronto anatomico e micromorfologica tra Ficus microcarpa L., F. nitida Thumb. e F. retusa L. ( Moraceae)
2006
Sulla presenza di alcuni interessanti funghi ipogei in Sicilia
2008
The role of phanerogams and cryptogams in the recolonization of cork oak forests crossed by wildfire in Sicily
2017
The actual distribution and structure of cork oak woods is the result of a process of anthropogenic alteration (utilization of cork, deforestation, coppicing, overgrazing, changes in land use, fire). Additional causes of threats in Q suber woods are pests and fungal disease. Although cork oak is an active pyrophyte the decortication of trunks makes trees more vulnerable to external agents and to fire in particular. Post-fire species are mainly carbonicolous fungi, some Ascomycetes make their appearance after around six weeks while other fungi begin to appear from the second year. The proliferation of fungal hyphae in the ash, as well as of some pioneer mosse protonemata, promotes soil aggre…
Azioni di conservazioni volte alla salvaguardia di Pleurotus nebrodensis, specie rara a rischio di estinzione
2007
Tamarix arborea var. subvelutina (Tamaricaceae), new from Spain
2009
Trifolium bivonae Guss. endemismo edafico della Sicilia settentrionale: considerazioni sulla sua distribuzione, biologia ed ecologia
2004
FUNGAL DIVERSITY IN URBAN FOREST ECOSYSTEMS
2014
In past and recent times the anthropic pressure strongly influenced the dynamic of forest ecosystems in Europe and led to a drastic decrease of forest cover and distribution mainly in unmanaged areas. The term “urban and community forests” refers to the trees and forests found in urbanized settings, in the center of cities and towns, in suburbs and rural ommunities, and at the edge of wild lands. Trees in the urban environment are subjected to a number of stresses which are very different from those suffered by trees in typical rural conditions. Biodiversity has been reduced in urban areas through ecosystem destruction, degradation, and fragmentation of remaining ecosystems. Recent investig…
Antimicrobial Activity of the Desert Truffles "Tirmania pinoyi" and "Terfezia claveryi" Against Human Pathogens
2015
The development of novel antimicrobials in the struggle against pathogens and antibiotic resistance is one of the most important global challenges of our time. Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial and immune stimulating properties1. In recent years the traditional studies on epigeous higher Basidiomycetes have been joined by those on hypogeous fungi and in particular on the so-named “desert truffles”. Ali2 demonstrated that organic extraction of truffles of genus Tirmania and Terfezia possess antimicrobial activity with broad-spectrum effects against Gram positive, Gram negative, aerobic and anaerobic bacteria …
On the presence of Tamarix africana Poir. var. fluminensis (Maire) Baum. (Tamaricaceae) in Calabria
2008
Mycoforestry in Sicily: a proposal to enhance the multifunctionality of forests
2017
Mycoforestry is forestry that aims to build on traditional rules to encourage forest ecosystem resilience while creating optimal conditions for fungal communities. Main goals of mycoforestry are: preservation of native forests, recovery and recycling of woodland debris, enhancement of replanted trees, strengthening sustainability of ecosystems, economic diversity. There is a large variety of fungi living in forests, each of which has a specific and complementary relationship to the diversity of native species, the ages of trees, the presence of dead trees or rich forest litter, etc. Fungi are the main responsible of wood decomposition and thus carbon and nutrient cycling, and they also form…
Indagini morfo-anatomiche ed ecologiche su endemiche sicule appartenenti ai generi Euphorbia L. e Centaurea L.
2005
The nutritional and medicinal value of Pleurotus species from Italy
2015
The genus Pleurotus is a cosmopolitan group of fungi which comprises ca. 30 species and subspecific taxa. The genus Pleurotus also represents the second main group of cultivated edible mushrooms in the world. The Pleurotus species are efficient colonizers and bioconverters of lignocellulosic agro‐industrial residues into palatable human food with medicinal properties. Besides Pleurotus species demonstrates significant nutritional and their bioactive compounds (mainly polysaccharides) possess antibacterial, antibiotic, antitumor, hypocholesterolemic and immunomodulation properties. Extracts of the Mediterranean culinary‐medicinal Oyster mushrooms P. eryngii var. eryngii, P. eryngii var. feru…
The tamarisks of southern Calabria (Italy)
2008
Antitumor activity of water extract of pleurotus species growing on root residues against colon cancer cells.
2012
Erysimum bonannianum ed E. metlesicsii (Cruciferae): nuovi contributi alla morfologia tassonomica
2004
La coltivazione del tartufo in Sicilia: risultati preliminari
2011
In recent times truffles were found in several natural forest ecosystems and reaforestation of Sicily. On the basis of these findings a number of research projects were activated. In the framework of an agreement between the Laboratory of Mycology of the Department of Botany (University of Palermo) and the Farm "Buontempo-Le Due Sicilie", located in the territory of the Madonie Natural Park, a first attempt to cultivate truffles of economic importance were carried out. In the spring of 2006 the experimental truffle-bed was developed on the basis of 100 seedlings of Corylus avellana L. inoculated with Tuber aestivum Vitt. (80%) and T. melanosporum Vittad. (20%). Besides 110 seedlings of Quer…
Taxonomy and Molecular Phylogeny within the Pleurotus eryngii Species-Complex
2007
The effect of grazing in a Mediterranean forest ecosystem
2010
The current state of knowledge of fungal diversity in Sicily (Southern Italy)
2007
The paper deal with the status of fungal biodiversity in Sicily. 1500 taxa, growing in different types of vegetation, are distributed in the nine provinces of the region. In this contribution a preliminary list of rare and infrequent species is also provided.
Elenco dei macromiceti raccolti in Sicilia in occasione del XVIII Seminario Internazionale di Micologia
2006
Studio morfologico dei taxa afferenti al genere ficusL. presenti nell'Orto botanico e nei giardini storici di Palermo
2005
The nutritional value of Leccinum corsicum, aniche product from Sicily (southern Italy)
2010
The nutritional value of Leccinum corsicum, a wild edible mushroom used as a food in many Italian regions and restricted communities of Sicily, is here evaluated. The results show that L. corsicum is a valuable niche product and an important source of nutritional elements for the human diet.
Fungal biodiversity in old-growth forests of Sicily: preliminary results
2014
According to several authors an old-growth forest in Italy is a natural forest in which human disturbance is absent or negligible, and in which natural dynamics create a mosaic of all the forest regeneration phases, including the senescing one. Such phase is characterized by large old trees, deadwood (snags logs and coarse woody debris) and a vascular plant species composition that is consistent with the bio-geographical context and it includes highly specialized taxa related to the small-scale disturbance and the microhabitats resulting from structural heterogeneity. Unmanaged forests are the main refugee for rare and endangered species, including fungi. In Sicily, 472 hectares were recogn…
A new record of the desert truffle Picoa lefebvrei in Saudi Arabia
2012
A new record of Picoa lefebvrei from Saudi Arabia is reported accompanied by notes on its taxonomy, ecology, and distribution.
I funghi ipogei dell'Emilia Romagna e della Sicilia a confronto
2012
In questo lavoro vengono riportate le specie di funghi ipogei trovate in Emilia-Romagna ed in Sicilia in molti anni di ricerche condotte utilizzando cani addestrati. In totale sono state trovate ed identificate 57 specie di Ascomiceti ipogei e 59 specie di Basidiomiceti ipogei. In entrambe le regioni sono diffuse specie eduli di elevato valore commerciale quali T. aestivum e T. borchii, mentre T. magnatum e T. macrosporum sono presenti solo in Emilia Romagna. T. melanosporum fruttifica, anche se raro, in Emilia Romagna e, nonostante alcuni raccoglitori ne ipotizzano la presenza in Sicilia, non è stato ancora trovato nell’ambito delle nostre ricerche. Alcune specie, in parte rare, sono state…
I tartufi e la tartuficoltura in Sicilia. Attualità e prospettive
2009
Contribution to the knowledge of fungal diversity in the archaeological park of Selinunte (S.-W. Sicily)
2012
The Archaelogical Park of Selinunte (S.-W.- Sicily) is included in the SIC (Sites of Community Interest) named “Dunal system Capo Granitola, Porto Palo e Foce del Belice” (code ITA010011). It includes a dunal system that is steadily towards the inland with sandy substrates which tend to characterize little evolved soils on silico-arenaceous matrix with alkaline pH. The climate of the site belong to the thermo-mediterranean belt (annual average temperature around 18 ° C), and upper dry ombrotype (average annual rainfall of 500 mm) [1]. The biotope also includes wetlands, Pinus halepensis Miller and Eucalyptus camaldulensis Dehnh reforestations, evergreen sclerophyllous vegetation with apreva…
Pollen grain in Tamarix arborea var. arborea
2011
The diffusion in the Italian territory, as wild and cultivated plant, of T. arborea (Sieb. ex Ehrenb.) Bge. var. arborea resulted wider than us could be waited for (Venturella et al., 2007). T. arborea var. arborea is characterized by aestival inflorescences composed of racemes and vernal inflorescence simple. The racemes are not longer than 6 cm long and 5 mm broad (Baum, 1978). The species is not still well investigated from the anatomical (leaf, root and stem) and palynological point of view. Nair (1962) investigated the Indian species of tamarisks and reported for T. arborea the following concise description: prolate, 27 × 18 μm, type of pollen grains with irregular reticulum. In order …
New distributive and ecological data on Tuber magnatum (Tuberaceae) in Italy
2014
The recent discovery of natural truffle grounds of the prized Tuber magnatum Pico in Sicily (southern Italy) allows to up-to-date the ecology and distribution of this choice edible mushroom in Italy and opens new economic opportunities in rural areas traditionally suffering from the economic point of view. The two new localities reported expand the southern range border of the species in Italy and Europe.
Contributo alla conoscenza della biodiversità fungina delle Riserve Naturali della Sicilia: Serre di Ciminna (Ciminna, Palermo)
2007
Nuovi contributi morfoanatomici per una migliore discriminazione tassonomica del genere Ficus (Moraceae): Ficus sycomorus L. e Ficus magnifolia F. Mu…
2004
First morphological and molecular investigation of the mycobiota associated with Astragalus nebrodensis in its natural environment (Madonie mountains…
2023
Although Astragalus nebrodensis plays a fundamental ecological role, mycorrhizal fungi associated with this species have never been investigated in natural habitats. Our aim was to check the presence and occurrence of Arbuscular Mycorrhizal Fungi (AMF) in roots of A. nebrodensis in a natural habitat and to screen the fungal diversity in the surrounding soil, considering the positive influence of mycotrophic shrub species on soil microbiota. A morphological analysis was performed on A. nebrodensis roots samples from the Madonie mountains (Sicily, Italy), while high-throughput-sequencing was carried out in A. nebrodensis roots and in the associated soil. Observations of A. nebrodensis roots r…