0000000001331053

AUTHOR

Vincenzo Arizza

showing 239 related works from this author

Antimicrobial peptides from echinoderms as antibiofilm agents: a natural strategy to combat bacterial infections

2014

AbstractIncreased attention has been focused on marine invertebrates as a source of bioactive molecules for biomedical applications. Many bioactive molecules are part of the innate immune system. Some more recently isolated compounds, mainly from the sea urchin and the sea cucumber, are antimicrobial peptides (AMPs) active against Gram-positive and Gram-negative bacteria, and fungi. In this review we described the most recent studies on AMPs isolated from echinoderms. AMPs are small peptides (< 10 kDa) with cationic charge and amphipathic structure. Recently, it was demonstrated that in the coelomocyte lysates of Paracentrotus lividus and Holothuria tubulosa, AMPs possess activity against s…

Innate immune systembiologyPseudomonas aeruginosaAntimicrobial peptidesHolothuria tubulosaSettore BIO/05 - Zoologiabiology.organism_classificationmedicine.disease_causeParacentrotus lividusAntimicrobial peptides echinoderm Paracentrotus lividus Holothuria tubulosa antibiofilmMicrobiologySea cucumbermedicineAnimal Science and ZoologyCoelomocyteBacteria
researchProduct

Presence and biodistribution of perfluorooctanoic acid (PFOA) in Paracentrotus lividus highlight its potential application for environmental biomonit…

2021

AbstractThe first determination of presence and biodistribution of PFOA in ninety specimens of sea urchin Paracentrotus lividus from two differently contaminated sites along Palermo’s coastline (Sicily) is reported. Analyses were performed on the sea urchins’ coelomic fluids, coelomocytes, gonads or mixed organs, as well as on seawater and Posidonia oceanica leaves samples from the collection sites. PFOA concentration ranged between 1 and 13 ng/L in seawater and between 0 and 794 ng/g in P. oceanica. The analyses carried out on individuals of P. lividus from the least polluted site (A) showed PFOA median values equal to 0 in all the matrices (coelomic fluid, coelomocytes and gonads). Conver…

ScienceSettore BIO/05 - ZoologiaBioconcentrationChemicalParacentrotus lividusArticleEnvironmental impactchemistry.chemical_compoundbiology.animalBiomonitoringAnimalsSeawaterTissue DistributionWater PollutantsSea urchinSaline WatersFluorocarbonsMultidisciplinarybiologyEcologyChemistryQRSettore CHIM/06 - Chimica Organicabiology.organism_classificationEnvironmental sciencesEnvironmental chemistryBioaccumulationPosidonia oceanicaEnvironmental chemistryParacentrotusPerfluorooctanoic acidMedicineSeawaterCaprylatesWater Pollutants ChemicalEnvironmental Monitoring
researchProduct

Antimicrobial and antistaphylococcal biofilm activity from the sea urchin Paracentrotus lividus

2010

Aims:  Staphylococcal biofilm-associated infections are resistant to conventional antibiotics. Consequently, new agents are needed to treat them. With this aim, we focused on the effector cells (coelomocytes) of the sea urchin Paracentrotus lividus immune system. Methods and Results:  We tested the activity of the 5-kDa peptide fraction of the cytosol from coelomocytes (5-CC) against a group of Gram-positive, Gram-negative bacteria and fungi. We determined minimal inhibitory concentrations (MICs) ranging from 253·7 to 15·8 mg ml−1. We observed an inhibitory activity and antibiofilm properties of 5-CC against staphylococcal biofilms of reference strains Staphylococcus epidermidis DSM 3269 an…

biologymedicine.drug_classAntibioticsAntimicrobial peptidesBiofilmGeneral Medicinemedicine.disease_causebiology.organism_classificationAntimicrobialApplied Microbiology and BiotechnologyParacentrotus lividusMicrobiologyStaphylococcus aureusStaphylococcus epidermidismedicineBacteriaBiotechnologyJournal of Applied Microbiology
researchProduct

AUTOPHAGY AND APOPTOSIS MODULATION BY AQUEOUS EXTRACTS FROM LEAVES AND RHIZOMES OF Posidonia oceanica ON HEPG2 HEPATOCARCINOMA CELLS

2023

Settore CHIM/10 - Chimica Degli Alimenticell biology caspases LC3 Beclin-1 p62/SQSTM1 hsp60 BCL2 BAX BAD FOS JUN DAPK western blot flow cytometry real time PCR acidic vesicular organelles annexin bindingSettore BIO/05 - ZoologiaSettore BIO/06 - Anatomia Comparata E Citologia
researchProduct

Anthropic impact, bioactive molecules, sustainable development, my keyword? Biodiversity!

2023

Biodiversity is my main research focus and that of my research group. We study a range of different aspects concerning biodiversity, such as the impact anthropic activities have on biodiversity and how to improve its preservation, its use as a valuable resource for the extraction of bioactive molecules, and the study of its distribution. The research group has over twenty years of experience in the study of zoology, and, more in particular, the immune and behavioural responses of aquatic invertebrates and fish. For many years, the group has observed the effects of various anthropogenic activities, such as the acoustic and chemical impacts on the physiological and behavioral responses of inv…

fishstrebehavioural responseinvertebrateSettore BIO/05 - Zoologiamolecular responseSettore BIO/06 - Anatomia Comparata E Citologiabiochemical responsebiodiversity
researchProduct

Retraction notice to "Isolation and confirmation of viral nervous necrosis (VNN) disease in golden grey mullet (Liza aurata) and leaping mullet (Liza…

2019

General VeterinarybiologyZoologyGeneral MedicineIsolation (microbiology)biology.organism_classificationMicrobiologyGolden grey mulletLeaping mulletVeterinary microbiology
researchProduct

EFFECT OF EXTRACTS FROM LEAVES AND RHIZOMES OF THE SEAGRASS POSIDONIA OCEANICA ON HEPG2 HEPATOCARCINOMA (HCC) CELLS

2022

Posidonia oceanica Hepg2 cells cytotoxicity liver cancer apoptosis autophagy ROS productionSettore BIO/05 - ZoologiaSettore BIO/06 - Anatomia Comparata E Citologia
researchProduct

Evolutionary and transcriptional analyses of a pentraxin-like component family involved in the LPS inflammatory response of Ciona robusta

2020

Pentraxins (PTXs) are a superfamily of conserved proteins which are components of the humoral arm of innate immunity. They are considered to be functional ancestors of antibodies and are classified into short and long types. In this study, we show that a pentraxin-like component (Ptx-like) with a C-terminal PTX domain, highly homologous to the short PTX of H. sapiens CRP, and a long N-terminal domain typical of long PTXs, is involved in the inflammatory response of Ciona robusta under LPS exposure in vivo. Analyses of protein domains as well as 3D modelling and phylogenetic tree supported the close relationship of Ptx-like with mammalian CRP, suggesting that C. robusta Ptx-like shares a com…

Lipopolysaccharides3D model0301 basic medicineLPSTranscription GeneticProtein domainSettore BIO/05 - ZoologiaChordateSettore BIO/08 - AntropologiaAquatic ScienceEvolution Molecular03 medical and health sciencesDownregulation and upregulationIn vivoAnimalsEnvironmental ChemistryCiona robustaPTXsInflammationInnate immune systemPentraxinsbiologyPhylogenetic tree04 agricultural and veterinary sciencesGeneral Medicinebiology.organism_classificationImmunity InnateCiona intestinalisCell biologyC-Reactive Protein030104 developmental biologyMultigene Family040102 fisheriesbiology.protein0401 agriculture forestry and fisheriesAntibodyFish &amp; Shellfish Immunology
researchProduct

Ciona robusta macrophage migration inhibitory factor (Mif1 and Mif2) genes are differentially regulated in the lipopolysaccharide-challenged pharynx

2023

The effects of lipopolysaccharide (LPS) on Mif (macrophage migration inhibitory factor) gene expression in the pharynx (haemapoetic tissue) of Ciona robusta were investigated using quantitative reverse-transcription PCR (qRT-PCR) and in situ hybridisation (ISH). To verify the induction of an inflammatory response in the pharynx, a qRT-PCR analysis was performed to evaluate the change in the expression of proinflammatory marker genes such as Mbl, Ptx-like, Tnf-α and Nf-kb, which were shown to be upregulated 1 h post LPS challenge. The change in the expression of the two Mif paralogs in the pharynx was assessed before and after stimulation, and qRTPCR and ISH results showed that, although Mif…

Ciona robusta inflammatory response lipopolysaccharide macrophage migration inhibitory factor
researchProduct

Morphological characterization of the blood cells in the endangered Sicilian endemic pond turtle,Emys trinacris(Testudines: Emydidae)

2014

AbstractIn this study, measurements of morphological parameters, sizes and frequencies of peripheral blood cells (erythrocytes, leukocytes, thrombocytes) on blood smear preparation devices stained with May-Grunwald stain were evaluated for both sexes in 20 Emys trinacris (Testudines: Emydidae) specimens. Erythrocytes were higher in male than in female specimens. The leukocyte of E. trinacris contains eosinophil, basophil, monocyte, heterophil and lymphocyte. The eosinophil was higher in males than in females whereas lymphocytes were higher in females than in males. The erythrocyte morphological parameters (EL [erythrocyte length], EW [erythrocyte width], L/W [length/width], ES [erythrocyte …

EmysbiologyEmys orbicularisLymphocyteEndangered speciesTurtle (syntax)Settore BIO/05 - ZoologiaZoologyEmydidaeAnatomyEosinophilbiology.organism_classificationmedicine.anatomical_structureblood smearEmys trinacrisEmys trinacris; blood smear; blood cell morphology; Trachemys scripta elegansmedicineblood cell morphologyAnimal Science and ZoologyEmys trinacriTrachemys scripta elegans
researchProduct

Citocentrifugación como un método adicional para estudiar celomitos de equinodermos: un enfoque comparativo que combina células vivas, preparaciones …

2021

Abstract Introduction: Echinoderm coelomocytes have traditionally been investigated through a morphological approach using light microscopy, which relies on the idea of constant cell shape as a stable character. However, this can be affected by biotic or abiotic conditions. Objective: To analyze if the consistency in cell morphology offered by the cytocentrifugation method, might be used as a convenient tool to study echinoderm coelomocytes. Methods: Cells of Echinaster (Othilia) brasiliensis (Asteroidea), Holothuria (Holothuria) tubulosa (Holothuroidea), Eucidaris tribuloides, Arbacia lixula, Lytechinus variegatus, and Echinometra lucunter (Echinoidea) were spread on microscope slides by c…

Comparative cell morphologyenergy-dispersive x-ray spectroscopyinmunología de invertebradosinvertebrate immunologyEnergy-dispersive x-ray spectroscopycomparative cell morphologyvibratile cellscélulas vibrátilesMicroscopyFluorescence microscopecomparative cell morphology; echinoderm physiology; energy-dispersive x-ray spectroscopy; invertebrate immunology; spherulocytes; vibratile cells.morfología celular comparativa; fisiología de equinodermos; espectroscopía de rayos-x de energía dispersiva; inmunología de invertebrados; esferulocitos; células vibrátiles.Arbacia lixulaesferulocitosLytechinus variegatusVibratile cellsespectroscopía de rayos-x de energía dispersivamorfología celular comparativabiologyechinoderm physiologyChemistryEchinoderm physiologyEchinometra lucunterbiology.organism_classificationspherulocytesSpherulocytesfisiología de equinodermosEchinodermBiochemistryEucidaris tribuloidesInvertebrate immunologyGeneral Agricultural and Biological SciencesHolothuriaRevista de Biología Tropical
researchProduct

CHERAX DESTRUCTOR (CLARK, 1836) AND CHERAX QUADRICARINATUS (VON MARTENS, 1868): SAFETY AND NUTRITIONAL QUALITY- Premio "YOUNG INVESTIGATOR AWARD"

2022

Two species of freshwater Parastacidae (Cherax quadricarinatus and Cherax destructor) are used for breeding in several country and to date also in Italy in one aquaculture plant located near Catania (Sicily). Although they are Australian, they seem to have some of the peculiar properties that make it important, strategic and highly appreciated species for aquaculture facilities in Italy. In fact, they mature early, have multiple reproductive cycles in a year, females can lay over a thousand eggs in a single brood and seem to tolerate wide ranges of temperature (Haubrock et al., 2021). Several authors have studied the Cherax genus from different points of view: diseases, moulting phases and …

nutritional propertiecrustaceanBiochemical parameter
researchProduct

Bright spots in the darkness of cancer: A review of starfishes-derived compounds and their anti-tumor action

2019

The fight against cancer represents a great challenge for researchers and, for this reason, the search for new promising drugs to improve cancer treatments has become inevitable. Oceans, due to their wide diversity of marine species and environmental conditions have proven to be precious sources of potential natural drugs with active properties. As an example, in this context several studies performed on sponges, tunicates, mollusks, and soft corals have brought evidence of the interesting biological activities of the molecules derived from these species. Also, echinoderms constitute an important phylum, whose members produce a huge number of compounds with diverse biological activities. In…

marine invertebratesOceans and SeasStarfishSea-starPharmaceutical ScienceContext (language use)Antineoplastic AgentsReviewNatural compoundMarine species03 medical and health sciencesStarfish0302 clinical medicineAnti-cancer activitymolecular drugsNeoplasmsDrug Discoverymedicinenatural compoundsAnimalsHumansGlycosidesPharmacology Toxicology and Pharmaceutics (miscellaneous)lcsh:QH301-705.5Molecular drug030304 developmental biologyAntitumor activity0303 health sciencesBiological ProductsbiologyPhylumMarine invertebrateCancerMarine invertebratesmedicine.diseasebiology.organism_classificationInvertebratesHuman tumorlcsh:Biology (General)Evolutionary biology030220 oncology & carcinogenesis
researchProduct

Are there autochthonous Ferrissia (Mollusca: Planorbidae) in the Palaearctic? Molecular evidence of a widespread North American invasion of the Old W…

2017

In the last few decades, findings of freshwater limpets belonging to the genus Ferrissia have been frequent and widely distributed throughout the Palaearctic and beyond. The widespread presence of a Nearctic alien taxon was proved, but no consensus was achieved about the possible existence of autochthonous Ferrissia taxa in the area, an occurrence which would be supported by the presence of gastropod fossils attributed to the genus throughout Eurasia and North Africa. In order to test the hypothesis of a possible persistence of autochthonous Ferrissia taxa in the Palaearctic to the present day, all the published data on the genetic diversity of Ferrissia populations occurring in the area we…

0106 biological sciencesOld Worldgenetic paradox of invasionsSettore BIO/05 - ZoologiaBiology010603 evolutionary biology01 natural sciencesGenusLarge ribosomal subunitNearctic ecozonelcsh:Zoologylcsh:QL1-991Biological invasionsFerrissia californicaGenetic diversityEcology010604 marine biology & hydrobiologycryptic invasionscryptic invasionBiological invasions; cryptic invasions; Ferrissia californica; genetic paradox of invasions; Animal Science and Zoologybiology.organism_classificationTaxonPlanorbidaeFerrissiaAnimal Science and ZoologyBiological invasiongenetic paradox of invasion
researchProduct

A lytic mechanism based on soluble phospholypases A2 (sPLA2) and b-galactoside specific lectins is exerted by Ciona intestinalis (ascidian) unilocula…

2011

Abstract Hemocytes from the ascidian Ciona intestinalis exert in vitro Ca 2+ -dependent cytotoxic activity toward mammalian erythrocytes and K562 cells. To examine the lytic mechanism, hemocyte populations were separated (B1–B6 bands) through a Percoll discontinuous density gradient, the hemocyte cytotoxic activity (HCA) and the lytic activity of the hemocyte lysate supernatant (HLS) were assayed. In addition the separated hemocytes were cultured and the cell-free culture medium (CFM) assayed after 3 h culture. Results support that unilocular refractile hemocytes (URGs), enriched in B5, are cytotoxic. The B5-HLS contains lysins and the activity of B5-CFM shows that lysins can be released in…

HemocytesPhospholipase A2 Inhibitorsmedicine.medical_treatmentLysinDibucaineSettore BIO/05 - ZoologiaAquatic ScienceBiologyFucoseCell membranechemistry.chemical_compoundmedicineEnvironmental ChemistryAnimalsHumansCiona intestinalisLectins C-TypeEnzyme InhibitorsProteaseErythrocyte MembraneGeneral Medicinebiology.organism_classificationCytotoxicity Tests Immunologicbeta-GalactosidaseGalactosideCiona intestinalisPhospholipases A2medicine.anatomical_structurechemistryBiochemistryLytic cycleInvertebrate immunity Ciona intestinalis Hemocyte Cytotoxicity Soluble phospholipase A2 Rabbit erythrocyte K562QuinacrineCaspasesImmunologyMicroscopy Electron ScanningRabbitsK562 CellsPercoll
researchProduct

The prophenoloxidase system is activated during the tunic inflammatory reaction of Ciona intestinalis

2008

Phenoloxidase (PO) activity was examined in the tunic tissue of Ciona intestinalis following lipopolysaccharide (LPS) intratunic injection. Tunic homogenate supernatant (THS), assayed with the Dopa-MBTH reaction, displayed Ca(2+)-independent PO activity that was raised by LPS and further enhanced by proteases. Specific inhibitors (tropolone, phenylthiourea, diethylthiocarbamate) supported the specificity of the reaction. Assay with soybean trypsin inhibitor showed that, in the tunic, PO activation with trypsin was not significantly inhibited suggesting that proteases diverse from serine proteases were involved. In vivo experiments were carried out by injecting isosmotic medium or LPS, and T…

LipopolysaccharidesProteasesHistologyBlotting WesternSettore BIO/05 - ZoologiaEnzyme-Linked Immunosorbent AssayPathology and Forensic MedicinemedicineAnimalsCiona intestinalisInflammationchemistry.chemical_classificationEnzyme PrecursorsbiologyKunitz STI protease inhibitorprophenoloxidase Ciona intestinalisCell BiologyProphenoloxidasebiology.organism_classificationTrypsinImmunohistochemistryMolecular biologyIn vitroCiona intestinalisUp-RegulationCionaEnzymechemistryPhenoloxidase . Hemocyte . Tunic . Inflammation . Lipopolysaccharide . SDS-polyacrylamide gel electrophoresis . Ciona intestinalisElectrophoresis Polyacrylamide GelCatechol Oxidasemedicine.drugCell and Tissue Research
researchProduct

FISH WASTE, NOT A PROBLEM BUT A POSSIBLE SOLUTION: CHITOSAN EXTRACTS AND NEW PACKAGING POSSIBILITIES.

2021

The fishing industry is one of the oldest industries in Europe and also one of the most important economic resources in the Mediterranean area. However, to date, in addition to creating considerable economic wealth, the various sectors (markets, restaurants, shops, etc.) also create significant levels of fish waste. If not processed or recycled adequately, these waste streams can lead to environmental degradation and severe pollution (Gao et al., 2018). Although today fish waste is considered a potential resource to generate high-added value, current practices in the fishing industry do not fully exploit its biological potential. Amongst the various possibilities for reuse, the production o…

antimicrobial activitygrape seed oilchitosanbiofilm
researchProduct

In vitro anti-biofilm activity of Boswellia spp. oleogum resin essential oils

2009

Aims:  To evaluate the anti-biofilm activity of the commercially available essential oils from two Boswellia species. Methods and Results:  The susceptibility of staphylococcal and Candida albicans biofilms was determined by methyltiazotetrazolium (MTT) staining. At concentrations ranging from 217·3 μg ml−1 (25% v/v) to 6·8 μg ml−1 (0·75% v/v), the essential oil of Boswellia papyrifera showed considerable activity against both Staphylococcus epidermidis DSM 3269 and Staphylococcus aureus ATCC 29213 biofilms. The anti-microbial efficacy of this oil against S. epidermidis RP62A biofilms was also tested using live/dead staining in combination with fluorescence microscopy, and we observed that …

Staphylococcus aureusTetrazolium SaltsMicrobial Sensitivity Testsmedicine.disease_causeApplied Microbiology and BiotechnologyBacterial Adhesionlaw.inventionMicrobiologylawStaphylococcus epidermidisCandida albicansmedicineOils VolatileStaphylococcus epidermidisBoswelliaCandida albicansBoswelliaBoswellia C albicans biofilms essential oils staphylococcal biofilmsEssential oilMicrobial ViabilitybiologyStaining and LabelingBiofilmbiochemical phenomena metabolism and nutritionbiology.organism_classificationCorpus albicansGrowth InhibitorsThiazolesStaphylococcus aureusBiofilmsBoswellia papyrifera
researchProduct

Antitumoral compounds from vertebrate sister group: A review of Mediterranean ascidians

2020

Among the diseases that afflict the human population, cancer is one for which many drug treatments are not yet known or effective. Moreover, the pharmacological treatments used often create serious side effects in sick patients and for this reason, it is essential to find effective and less harmful treatments. To date, marine biodiversity is a real source of metabolites with antitumoral activity and among invertebrates' ascidians have been the main source to obtain them. Mediterranean area is the richest in biodiversity and contains several ascidian species used in drugs development during the years. However, many more Mediterranean ascidian species have not been studied and could be a sour…

Mediterranean climateImmunologyPopulationBiodiversitySettore BIO/05 - ZoologiaZoologyAntineoplastic AgentsDrug developmentBiologyPeptides Cyclic01 natural sciencesAntitumoralchemistry.chemical_compoundDepsipeptidesNeoplasmsbiology.animalMediterranean SeaAnimalsHumansUrochordataInvertebrateSettore BIO/06 - Anatomia Comparata E CitologiaeducationCancerBiological Productseducation.field_of_study010405 organic chemistryfungiVertebrateBioactive compound0104 chemical sciencesMarine biodiversity010404 medicinal & biomolecular chemistryDrug developmentchemistrySister groupTunicatesBioactive compoundTrabectedinDevelopmental Biology
researchProduct

New molecular data attest to the absence of cospeciation patterns between Placobdella costata (Fr. Müller, 1846) (Hirudinea) and freshwater turtles (…

2021

The only Palearctic representative of the leech genus Placobdella Blanchard, 1893 is P. costata, an ectoparasite of freshwater turtles. To date, no conclusive evidence about the possible presence of coevolutionary patterns between this leech and its turtle hosts is available due to the paucity of DNA sequence data available for P. costata; moreover, comparative host data is also mostly lacking, making any inferences more difficult. The discovery of new populations of the species in northern Italy and Sicily allowed us to generate novel mitochondrial DNA sequences and to compare the topology of the resulting phylogenetic trees with the phylogeny of the turtle hosts occurring in the study are…

EmysPlacobdella costataSettore BIO/05 - ZoologiaZoologyshallow phylogeographyCoevolutionary patternGlossiphoniidaeBiologybiology.organism_classificationPleistocene refugiaCoevolutionary pattern; Glossiphoniidae; host-parasite relationships; Pleistocene refugia; shallow phylogeography;QL1-991CospeciationSettore BIO/03 - Botanica Ambientale E ApplicataAnimal Science and Zoologyhost-parasite relationshipsZoology
researchProduct

ANTIMICROBIAL ACTIVITY FROM POLYPEPTIDE-RICH EXTRACTS OF THE SEAGRASS POSIDONIA OCEANICA

2021

The present study was carried out to assess the antibacterial, antifungal and antibiofilm properties of polypeptide-rich extracts isolated from green leaves and rhizomes of Mediterranean seagrass Posidonia oceanica (L. Delile) (Posidoniaceae). The seagrass was collected, washed with freshwater, grinded with liquid nitrogen in order to obtain fine powders that were exposed to extraction by acetic acid and antiproteases. The crude extracts isolated from leaves and rhizomes of P. oceanica were subjected to microbiological assays to evaluate the antibacterial, antifungal and antibiofilm activity of polypeptide fraction against two reference bacterial strains Staphylococcus aureus ATCC 25923 and…

bioactive moleculemarine biodiversityseagraantimicrobial activityantifungal activity
researchProduct

Can phthalates move into the eggs of the loggerhead sea turtle Caretta caretta? The case of the nests on the Linosa Island in the Mediterranean Sea

2021

During the monitoring of Caretta caretta nests on the island of Linosa, 30 unhatched eggs from four nests were collected to study the presence of phthalates in their three components (shell, yolk, and albumen). Four phthalates, namely diethyl (DEP), dibutyl (DBP), di-(2-ethylhexyl) (DEHP), and dioctyl (DOTP) phthalic acid esters (PAE), which are widely used as additives in plastics, were detected in all egg components. The most frequently found phthalate was DBP, followed by DEHP in eggshell and yolk. Dimethyl- (DMP) and butylbenzyl-phthalate (BBP) were below the limits of detection for all samples. The high total phthalate recorded in the yolk suggests that contamination could arise by vit…

0106 biological sciencesfood.ingredientYolkPhthalic AcidsZoology010501 environmental sciencesAquatic ScienceOceanography01 natural sciencesLoggerhead sea turtlechemistry.chemical_compoundMediterranean seafoodPlasticizersYolkMediterranean SeaAnimalsEggshell0105 earth and related environmental sciencesIslandsAlbumenbiology010604 marine biology & hydrobiologyMaternal transferPersistent organic pollutantsPhthalateContaminationbiology.organism_classificationPollutionDibutyl PhthalateTurtlesPhthalic acidchemistryEggshellVitellogenesisPlastics
researchProduct

Underwater high frequency noise: Biological responses in sea urchin Arbacia lixula (Linnaeus, 1758)

2020

Marine life is extremely sensitive to the effects of environmental noise due to its reliance on underwater sounds for basic life functions, such as searching for food and mating. However, the effects on invertebrate species are not yet fully understood. The aim of this study was to determine the biochemical responses of Arbacia lixula exposed to high-frequency noise. Protein concentration, enzyme activity (esterase, phosphatase and peroxidase) and cytotoxicity in coelomic fluid were compared in individuals exposed for three hours to consecutive linear sweeps of 100 to 200 kHz lasting 1 s, and control specimens. Sound pressure levels ranged between 145 and 160 dB re 1μPa. Coelomic fluid was …

0106 biological sciencesPhysiologyPhosphataseZoology01 natural sciencesBiochemistryEsteraseHemolysis03 medical and health sciencesbiology.animalAnimalsHomeostasisHSP70 Heat-Shock ProteinsMatingSettore BIO/06 - Anatomia Comparata E CitologiaMolecular BiologySea urchinArbacia lixulaHSP70030304 developmental biologyInvertebrateCell ProliferationPeroxidaseArbacia0303 health sciencesbiologyEchinoderm010604 marine biology & hydrobiologyEsterasesMarine invertebrateMarine invertebratesbiology.organism_classificationAlkaline PhosphataseAcoustic stimuluEnzyme assayCoelomomycesBody Fluidsbiology.proteinMetabolomePhysiological stress.Noise
researchProduct

Humoral responses during wound healing in Holothuria tubulosa (Gmelin, 1788)

2021

Abstract Wounds in living organisms trigger tissue-repair mechanisms. The sea cucumber (Holoturia tubulosa) is an excellent model species for achieving a better understanding of the humoral and cellular aspects involved in such healing processes. Consequently, this study assesses data on its morphometric, physiological and humoral responses 1, 2, 6, 24 and 48h after wound induction. In particular, morphometric data on the weight, width, length and coelomic-fluid volume of the species were estimated at different times during our experiments. In addition, the humoral aspects related to the enzymatic activity of esterase, alkaline phosphatase and peroxidase, as well as the cytotoxic activity o…

PhysiologySettore BIO/05 - ZoologiaBiochemistryEsteraseCytotoxic activity Echinoderm Enzyme activity Regeneration mechanism Immunity sea cucumber03 medical and health sciencesSea cucumberAnimalsHolothuriaCytotoxic T cellSettore BIO/06 - Anatomia Comparata E CitologiaMolecular Biology030304 developmental biologyWound Healing0303 health sciencesSheepbiologyBody WeightHolothuria tubulosa04 agricultural and veterinary sciencesbiology.organism_classificationEnzyme assayFISIOLOGIABiochemistry040102 fisheriesbiology.protein0401 agriculture forestry and fisheriesAlkaline phosphataseRabbitssense organsWound healingPeroxidaseComparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology
researchProduct

CHEMICAL CHARACTERIZATION AND BIOLOGICAL PROPERTIES OF MACROALGAE EXTRACTS

2023

Marine species are a rich source of bioactive molecules and among them, it is known that marine algae produce different secondary metabolites for which different biological activities such as: immunomodulatory (Raposo et al., 2016), antioxidant (Fisch et al., 2003) and antimicrobial (Pinteus et al., 2015) were demostrated. The aim of this study was chemical charac- terize the extracts of three macroalgae species: Carpodesmia crinite (Duby, Orellana &amp; Sansón, 2019), Carpodesmia brachy- carpa (J. Agardh, Orellana &amp; Sansón 2019, WoRMS, 2023), Ericaria brachycarpa (J. Agardh, Molinari &amp; Guiry, 2020), Asparagopsis taxiformis (Delile) Trevisan 1845) to evaluate also their biological a…

macroalgaecoelomatic fluidSettore BIO/10 - BiochimicaSettore BIO/05 - ZoologiaantimicrobialSettore CHIM/06 - Chimica OrganicaSettore BIO/06 - Anatomia Comparata E Citologiasea urchinSettore AGR/16 - Microbiologia Agraria
researchProduct

The Portuguese Man-of-War Has Always Entered the Mediterranean Sea—Strandings, Sightings, and Museum Collections

2022

A search of records from different kinds of sources namely, scientific and grey literature, social media, and zoological museum collections, has been carried out to review the incidence of Physalia physalis (Linnaeus, 1758), the Portuguese man-of-war, in the Mediterranean Sea. The temporal frame of the records, considered valid if documented with images or collected specimens, ranged from the second half of the eighteenth century to the year 2021. Thanks to colonies preserved in some Italian historical museum collections, originating from the western basin, it was possible to date the putative first documented record of P. physalis of the Mediterranean Sea in 1850. The dataset shows some ma…

Settore L-ART/04 - Museologia E Critica Artistica E Del RestauroGlobal and Planetary ChangePhysalia physalisSettore BIO/05 - ZoologiaZoological collectionsOcean EngineeringCitizen scienceAquatic ScienceOceanographyTourism sectorDangerous speciesPhysalia physalis zoological collections dangerous species citizen science tourism sector Mediterranean biodiversityMediterranean biodiversityWater Science and TechnologyFrontiers in Marine Science
researchProduct

Isolation and confirmation of viral nervous necrosis (VNN) disease in golden grey mullet (Liza aurata) and leaping mullet (Liza saliens) in the Irani…

2016

The present study was conducted on 428 moribund mullet fish samples to isolate and identify the causative agent of a mysterious acute mortality which recently occurred in wild mullets in Iranian waters of Caspian Sea, suspected to be due to viral nervous necrosis (VNN) disease. Disease investigation was carried out employing various diagnostic procedures such as virology, bacteriology, parasitology, haematology, histopathology, IFAT, IHC and nested RT-PCR. Brain and eye samples of affected fishes were collected in sterile conditions and then kept at -80 °C for cell culture isolation and nested RT-PCR detection of the causative agent. Other tissue samples were also collected and fixed for hi…

medicine.medical_specialtyVeterinary medicinePathology040301 veterinary sciencesCaspian sea; Golden grey mullet (Liza aurata); Iran; Leaping mullet (Liza saliens); Viral nervous necrosisOceans and SeasViral nervous necrosisBetanodavirusSettore BIO/05 - ZoologiaBiologyIranMicrobiologyPolymerase Chain ReactionMulletCell Line0403 veterinary scienceTissue cultureFish DiseasesRNA Virus InfectionsMicroscopy Electron TransmissionmedicineCaspian seaAnimalsNodaviridaeFluorescent Antibody Technique IndirectGeneral VeterinaryOutbreak04 agricultural and veterinary sciencesGeneral Medicinebiology.organism_classificationImmunohistochemistrySurvival AnalysisSmegmamorphaParasitology040102 fisheries0401 agriculture forestry and fisheriesHistopathologyGolden grey mullet (Liza aurata)Leaping mullet (Liza saliens)Golden grey mulletLeaping mulletVeterinary microbiology
researchProduct

The potential of antimicrobial peptides isolated from freshwater crayfish species in new drug development: A review

2021

Abstract The much-publicised increased resistance of pathogenic bacteria to conventional antibiotics has focused research effort on the characterization of new antimicrobial drugs. In this context, antimicrobial peptides (AMPs) extracted from animals are considered a promising alternative to conventional antibiotics. In recent years, freshwater crayfish species have emerged as an important source of bioactive compounds. In fact, these invertebrates rely on an innate immune system based on cellular responses and on the production of important effectors in the haemolymph, such as AMPs, which are produced and stored in granules in haemocytes and released after stimulation. These effectors are …

Innate immune systembiologymedicine.drug_classImmunologyAntibioticsAntimicrobial peptidesFresh WaterContext (language use)Pathogenic bacteriaAstacoideaGram-Positive Bacteriabiology.organism_classificationCrayfishAntimicrobialmedicine.disease_causeAnti-Bacterial AgentsMicrobiologyGram-Negative BacteriamedicineAnimalsAMP Antibiotic Bioactive compound Crustacea Invertebrate Pathogenic bacteriaAntimicrobial PeptidesBacteriaAntimicrobial Cationic PeptidesDevelopmental Biology
researchProduct

Does the immune answer to Bacillus thuringiensis infection is the same in larvae, females and males of Rhynchophorus ferrugineus?

2021

Bacillus thuringiensis (Bt) è considerato un potenziale batterio entomopatogeno per la lotta al Rhynchophorus ferrugineus, coleottero da quarantena infestante le palme. In questo lavoro si considerano gli effetti dell’infezione di Bt in larve, maschi e femmine del punteruolo rosso. La patogenicità è stata valutata stimando la LD50 (Lethal Median Dose) e la LT50 (Lethal Median Time), il numero totale di emociti ed il tipo di emociti (Differential Haemocytes counts) ed inoltre l’espressione delle proteine Heat Shock Protein 70 (HSP70) negli emociti e nel cerebro. La mortalità di entrambi i sessi e delle larve aumentava all’aumentare della dose e del tempo di esposizione. Tuttavia le larve han…

Median lethal dose median lethal time stress answer haemocytes brain HSP70.Settore AGR/11 - Entomologia Generale E ApplicataSettore BIO/05 - Zoologiadose letale mediana tempo letale mediano risposta allo stress emociti cerebro HSP70
researchProduct

Salmo salar fish waste oil: Fatty acids composition and antibacterial activity

2020

Background and aims Fish by-products are generally used to produce fishmeal or fertilizers, with fish oil as a by-product. Despite their importance, fish wastes are still poorly explored and characterized and more studies are needed to reveal their potentiality. The goal of the present study was to qualitatively characterize and investigate the antimicrobial effects of the fish oil extracted from Salmo salar waste samples and to evaluate the potential use of these compounds for treating pathogen infections. Methods Salmo salar waste samples were divided in two groups: heads and soft tissues. Fatty acids composition, and in particular the content in saturated (SAFAs), mono-unsaturated (MUFA…

Waste oilSalmo salarSettore BIO/05 - Zoologialcsh:MedicineMarine BiologyContext (language use)Fish oilGeneral Biochemistry Genetics and Molecular Biology03 medical and health sciencesFish mealFood scienceSalmo030304 developmental biologychemistry.chemical_classification0303 health sciencesMinimum inhibitory concentrationbiologyChemistryGeneral NeuroscienceWaste oil Polyunsaturated fatty acid Minimum inhibitory concentration Salmo salar Fish oil Copyrightlcsh:RWaste oil04 agricultural and veterinary sciencesGeneral MedicineFood Science and Technologybiology.organism_classificationFish oilAntimicrobialPolyunsaturated fatty acidAquaculture Fisheries and Fish Science040102 fisheries0401 agriculture forestry and fisheriesGeneral Agricultural and Biological SciencesAntibacterial activityZoologyPolyunsaturated fatty acidPeerJ
researchProduct

ANTIMICROBIAL AND ANTIBIOFILM ACTIVITY OF A PEPTIDE IDENTIFIED IN THE SEAGRASS POSIDONIA OCEANICA

2022

antimicrobial activitySettore BIO/05 - Zoologiaantibiofilm activityPosidonia oceanicaSettore BIO/06 - Anatomia Comparata E CitologiaSettore BIO/19 - Microbiologia Generale
researchProduct

In Vitro Cytotoxic Effect of Aqueous Extracts from Leaves and Rhizomes of the Seagrass Posidonia oceanica (L.) Delile on HepG2 Liver Cancer Cells: Fo…

2023

Aqueous extracts from Posidonia oceanica’s green and brown (beached) leaves and rhizomes were prepared, submitted to phenolic compound and proteomic analysis, and examined for their potential cytotoxic effect on HepG2 liver cancer cells in culture. The chosen endpoints related to survival and death were cell viability and locomotory behavior, cell-cycle analysis, apoptosis and autophagy, mitochondrial membrane polarization, and cell redox state. Here, we show that 24 h exposure to both green-leaf- and rhizome-derived extracts decreased tumor cell number in a dose–response manner, with a mean half maximal inhibitory concentration (IC50) estimated at 83 and 11.5 μg of dry extract/mL, respecti…

phenolic compoundreactive oxygen specieSettore CHIM/10 - Chimica Degli AlimentiGeneral Immunology and MicrobiologycaspaseSettore BIO/05 - Zoologiaproteomic analysiscell biology; cell cycle; reactive oxygen species; wound healing assay; caspases; mitochondrial transmembrane potential; clonogenic assay; phenolic compounds; proteomic analysisGeneral Biochemistry Genetics and Molecular Biologycell biologymitochondrial transmembrane potentialcell cycleclonogenic assaySettore BIO/06 - Anatomia Comparata E CitologiaGeneral Agricultural and Biological Scienceswound healing assayBiology
researchProduct

Echinoderm Antimicrobial Peptides to Contrast Human Pathogens

2013

Increased attention has been focused in marine invertebrates as a source of bioactive molecules for biomedical applications. Many bioactive molecules are part of the innate immune system. Some more recently isolated compounds, mainly from sea urchin and sea cucumber are antimicrobial peptides (AMP) active against Gram positive, Gram negative and fungi. In this review we described the most recent studies on AMP isolated from echinoderms. The AMP are little peptides <10 kDa with cationic charge and amphipathic structure. Recently, it was demonstrated that in the coelomocyte lysates of Paracentrotus. lividus and Holothuria tubulosa AMP are present with activity against staphylococcal and Pseud…

Innate immune systembiologyPseudomonas aeruginosaAntimicrobial peptidesHolothuria tubulosaHuman pathogenAntibiotic therapymedicine.disease_causebiology.organism_classificationSettore BIO/19 - Microbiologia GeneraleMicrobiologyEchinodermbiology.animalmedicineAntimicrobial peptideCoelomocyteSea urchinTherapeutic agent
researchProduct

Cytotoxic capability and the associated proteomic profile of cell-free coelomic fluid extracts from the edible sea cucumber Holothuria tubulosa on He…

2022

Hepatocellular carcinoma (HCC) is an aggressive cancer histotype and one of the most common types of cancer worldwide. The identification of compounds that might intervene to restrain neoplastic cell growth appears imperative due to its elevated overall mortality. The marine environment represents a reservoir rich in bioactive compounds in terms of primary and secondary metabolites produced by aquatic animals, mainly invertebrates. In the present study, we determined whether the water-soluble cell-free extract of the coelomic fluid (CFE) of the edible sea cucumber Holothuria tubulosa could play an anti-HCC role in vitro by analyzing the viability and locomotory behavior, cell cycle distribu…

Hepatocellular carcinoma invertebrate echinoderm cell behavior protein profileechinodermSettore CHIM/10 - Chimica Degli Alimenticell behaviorprotein profileinvertebrateSettore BIO/05 - Zoologiahepatocellular carcinomaSettore BIO/06 - Anatomia Comparata E Citologia
researchProduct

Haemolymphatic parameters in two aquaculture crustacean species Cherax destructor (Clark, 1836) and Cherax quadricarinatus (von Martens, 1868)

2021

The growing demand for animal proteins of aquatic origin such as fish, molluscs and crustaceans have prompted some European and Italian companies to focus their attention on some species of freshwater crustaceans such as Cherax destructor and Cherax quadricarinatus. They are among the largest freshwater decapods, matures early, females can lay over a thousand eggs in a single brood and has a broad environmental tolerance. All these characteristics make it highly appreciated species for aquaculture and few years ago their breeding has spread to Europe and recently also in Italy (Sicily). Although some commercial yabby farms have been studied these species from different points of view (dieta…

cellular parametercrustaceanfreshwaterCherax spp.biochemical response
researchProduct

Allograft Inflammatory Factor AIF-1: early immune response in the Mediterranean sea urchin Paracentrotus lividus

2020

Echinoderms are a phylum of deuterostomic invertebrates that play a key role in maintaining the biodiversity of marine ecosystems. They represent a good study model for immunity because their coelomic fluid contains different types of cells involved in the inflammatory response: the coelomocytes. In the case of the sea urchin Paracentrotus lividus, the coelomocyte population is mainly represented by amoebocytes and uncoloured spherulocytes that implement a defence program through phagocytosis, encapsulation, cytotoxicity, and production of antimicrobial agents. The purpose of this study was to find evidence of a possible modulating effect of lipopolysaccharide LPS on the expression of the A…

0106 biological sciences0301 basic medicineLipopolysaccharidesLipopolysaccharidePopulationSettore BIO/05 - ZoologiaLPS treatment010603 evolutionary biology01 natural sciencesParacentrotus lividus03 medical and health scienceschemistry.chemical_compoundImmune systemImmunitybiology.animalAnimalsAmino Acid SequenceRNA MessengerImmune responseSettore BIO/06 - Anatomia Comparata E CitologiaeducationCoelomocyteSea urchineducation.field_of_studybiologyBase SequenceEchinodermProteinsbiology.organism_classificationCell biology030104 developmental biologychemistryGene Expression RegulationParacentrotus lividusAllograft inflammatory factor 1ParacentrotusAnimal Science and ZoologyAIF-1
researchProduct

The use of an integrative approach to identify coelomocytes in three species of the genus Holothuria (Echinodermata)

2021

Coelomocytes in the Holothuroidea are traditionally identified according to their morphology through light, fluorescence, or electron microscopy. Former studies have typically used only one method, with few works combining two or more approaches. Studies using cytocentrifugation to study these cells are scarcer. Thus, for the first time, an integrative approach was used to compare coelomocytes in Holothuroidea. This approach consisted of living and stained cells, scanning electron microscopy (for spherule cells), and accurate morphometric analyses. Specifically, we used specimens of Holothuria grisea, Holothuria arenicola, and Holothuria tubulosa to test whether cytocentrifugation could be …

phagocytescytocentrifugationBIOLOGIA CELULARAnimal Science and Zoologyspherule cellsmaturation processsea cucumber
researchProduct

Effects of acoustic stimulation on biochemical parameters in the digestive gland of Mediterranean mussel Mytilus galloprovincialis (Lamarck, 1819)

2020

Underwater sounds generated by anthropogenic activity can cause behavior changes, temporary loss of hearing, damage to parts of the body, or death in a number of marine organisms and can also affect healing and survival. In this study, the authors examined the effects of high-frequency acoustic stimulations on a number of biochemical parameters in the Mediterranean mussel, Mytilus galloprovincialis. During the experiment, animals were placed in a test tank and exposed to acoustic signals [a linear sweep ranging from 100 to 200 kHz and lasting 1 s, with a sound pressure level range of between 145 and 160 dBrms (re 1μParms)] for 3 h. Total haemocyte count was assessed and glucose levels, cyto…

Mediterranean musselAcoustics and UltrasonicsZoologyStimulationBiology01 natural sciencesEsterase03 medical and health sciencesArts and Humanities (miscellaneous)Noise pollutionotorhinolaryngologic diseasesAnimalsInvertebrateImmune response030304 developmental biologyInvertebrateMytilus0303 health sciences010405 organic chemistryBivalvefood and beveragesbiology.organism_classificationMytilusEnzyme assay0104 chemical sciencesAcoustic Stimulationbiology.proteinAlkaline phosphataseMusselWater Pollutants Chemical
researchProduct

Eco-physiological response of two marine bivalves to acute exposition to commercial Bt-based pesticide

2013

Microbial products based on the entomopathogenic bacterium Bacillus thuringiensis (Bt) are among the most common biopesticides used worldwide to suppress insect pests in forests, horticulture and agricultural crops. Some of the effects of commercial Bt have been recorded for terrestrial and freshwater non-target organisms but little research is available on marine fauna. Nevertheless, due to the contiguity of agro-ecosystems and coastal habitats, marine fauna may be highly influenced by this control method. We studied the effect of a commercial Bt product on the physiological and ecological responses and the energy budget of two of the most frequent marine intertidal bivalves in the Mediter…

Settore BIO/07 - EcologiaBiopesticidesBiological pollutionFaunaBacillus thuringiensisSettore BIO/05 - ZoologiaAlien speciesBrachidontes pharaonisAquatic ScienceBiologyOceanographyBacillus thuringiensisAgricultural coastal areasAnimalsBacillus thuringiensiBrachidontes pharaoniEcosystemPesticidesAlien specieBiological pollutionAgricultural coastal areas; Alien species; Bacillus thuringiensis; Biological pollution; Biopesticides; Brachidontes pharaonis; Mytilaster minimusBacillus thuringiensis; Mytilaster minimus; Brachidontes pharaonis; Biological pollution; Biopesticides; Alien species; Agricultural coastal areasbusiness.industryEcologyMytilaster minimusPest controlHeartFeeding BehaviorGeneral MedicinePesticideMytilaster minimusbiology.organism_classificationPollutionBivalviaAgricultural coastal areaBiopesticideBiopesticideEnergy MetabolismbusinessWater Pollutants ChemicalMarine Environmental Research
researchProduct

AQUEOUS EXTRACTS FROM LEAVES AND RHIZOMES OF THE MARINE SEAGRASS POSIDONIA OCEANICA EXHIBIT ANTI-LIVER CANCER ABILITY IN VITRO

2022

cancer cells Poseidonia oceanica leaf extract rhizome extract cell viability cell cycle apoptosis autophagy cell locomotionSettore BIO/05 - ZoologiaSettore BIO/06 - Anatomia Comparata E Citologia
researchProduct

BROILER CHICKENS AND THEIR HEALTH STATUS IN FARM: WINE WASTE, AN ADDED VALUE ON FEEDING

2023

Various key economic sectors of the National and Sicilian economy, in addition to contributing to the economic growth also cause a considerable production of waste which today are a problem both for companies then for the environment. For this reason, there is considerable interest in this waste and in the possibility of their reuse to extract bioactive molecules with added value, all in accordance with the objectives of the Blue Economy. In this regard, it has already been demonstrated that from the production waste of various economic sectors it is possible to obtain bioactive molecules with anticancer, antimicrobial, cosmetic, antioxidant and nutraceutical properties (Mauro et al., 2022)…

wine wasteSettore CHIM/10 - Chimica Degli AlimentibloodSettore BIO/10 - Biochimicahealth statuSettore BIO/05 - Zoologiaantioxidant effectSettore BIO/06 - Anatomia Comparata E Citologiabiochemical parameteranimal welfare
researchProduct

Controlled uptake of PFOA in adult specimens of Paracentrotus lividus and evaluation of gene expression in their gonads and embryos

2023

AbstractPerfluorooctanoic acid (PFOA) has been largely used in the manufacturing industry but a few years ago it turned out to be a dangerous pollutant which is now of concern for terrestrial and aquatic environments. Here, we investigated the bioaccumulation of PFOA in the sea urchin Paracentrotus lividus after exposure to different concentrations of the pollutant for 28 days. We observed rapid uptake of PFOA in the coelomic fluid collected weekly during the exposure period and high bioaccumulation in gonads at the end of the experiment. Interestingly, animals were also able to fast depurate when relocated to a clean environment. In addition, to assess the effect of PFOA on sea urchins’ ph…

Persistent organic pollutant (POP)Health Toxicology and MutagenesisSettore BIO/05 - ZoologiaEnvironmental ChemistrySettore BIO/11 - Biologia MolecolareGene expressionGeneral MedicinePerfluorooctanoic acid (PFOA)Embryo developmentPerfluoroalkylated substances (PFAS)Sea urchinsPollutionSettore CHIM/12 - Chimica Dell'Ambiente E Dei Beni CulturaliEnvironmental Science and Pollution Research
researchProduct

First record of Temnosewellia minor (Platyhelminthes, Temnocephalidae) in Sicily, with a plea for a re-examination of the identity of the publicly av…

2021

Author(s): Vecchioni, Luca; Chirco, Pietro; Bazan, Giuseppe; Marrone, Federico; Arizza, Vincenzo; Arculeo, Marco | Abstract: Ectosymbiotic temnocephalan flatworms belonging to the genus Temnosewellia Damborenea and Cannon, 2001 were collected on Cherax destructor Clark, 1936 in an aquaculture farm in Sicily, Italy. This represents the first record of a temnocephalan species for the fauna of the island. Morphological and molecular identification of the collected specimens proved that they belong to the allochthonous species Temnosewellia minor Haswell, 1888, which was introduced along with crayfishes bred in aquaculture farms. The phylogenetic analyses carried out for the molecular identific…

Global and Planetary Changeeducation.field_of_studyEcologyPhylogenetic tree28S rDNAbusiness.industryFaunaPopulationIdentity (social science)Alien speciesCherax destructorArchaeologylanguage.human_languageEctosymbiontsGeographyPleaAquacultureGenuslanguagebusinesseducationSicilianEcology Evolution Behavior and Systematics
researchProduct

D.P14 In vitro cytotoxic activity against erythrocytes by ascidians hemocytes: Target/effector interactions

1994

The cell-mediated, calcium-dependent cytotoxic activity against mammalian erythrocytes by the hemocytes of the ascidians Ciona intestinalis and Stye/a plicata was investigated by in vitro cytotoxic assay (HCA). Hemocytes/erythrocytes mixtures were performed in artificial sea water or TBS enriched with 10 mM CaC12, at 25° or 3rC, and the released haemoglobin was estimated by reading the absorbance at 541 nm (Parrinello et al., D.C.I., 17:19, 1993). With the aim to examine the cytotoxic mechanism involved, inhibition experiments with lipidic components of the erythrocyte membrane have been carried out in TBS-Ca. Among the phospholipids tested sphingomyelin is an inhibitor of the Ciona intesti…

ImmunologyDevelopmental Biology
researchProduct

New insights into the gut microbiome in loggerhead sea turtles Caretta caretta stranded on the Mediterranean coast

2019

Caretta caretta is the most common sea turtle species in the Mediterranean Sea. The species is threatened by anthropomorphic activity that causes thousands of deaths and hundreds of strandings along the Mediterranean coast. Stranded turtles are often cared for in rehabilitation centres until they recover or die. The objective of this study was to characterize the gut microbiome of nine sea turtles stranded along the Sicilian coast of the Mediterranean Sea using high-throughput sequencing analysis targeting V3–V4 regions of the bacterial 16S rRNA gene. Stool samples were collected from eight specimens hosted in the recovery centre after a few days of hospitalization (under 7) and from one ho…

Mediterranean climateDIVERSITYSettore BIO/05 - ZoologiamicrobiomePathology and Laboratory MedicineSettore BIO/19 - Microbiologia GeneraleDatabase and Informatics MethodsMediterranean seacaretta carettaRNA Ribosomal 16SOceansMedicine and Health Sciencesbacteria0303 health sciencesMultidisciplinarybiologyDEBRIS INGESTIONQREukaryotaGenomicsTurtlesBacterial PathogensSea turtleMedical MicrobiologyVertebratesMedicinegutBACTERIAL COMMUNITIESPathogensProteobacteriaSequence AnalysisResearch ArticleBioinformaticsFirmicutesScienceSequence DatabasesFirmicutesmediterraneanZoologyMicrobial GenomicsResearch and Analysis MethodsMicrobiologyFusobacteriaDIET03 medical and health sciencesBodies of waterProteobacterialoggerheadGeneticsMediterranean SeaAnimalsMicrobiomeMicrobial Pathogens030304 developmental biologyBacteroidetes030306 microbiologyGut BacteriaOrganismsBiology and Life SciencesReptilesBacteroidetesbiology.organism_classificationEVOLUTIONMarine and aquatic sciencesGastrointestinal MicrobiomeEarth sciencesBiological DatabasesTestudinesAmniotesThreatened speciesCaretta caretta gut microbiome sea turtles Mediterranean Sea
researchProduct

Some like it cold: the glossiphoniid parasites of the Sicilian endemic pond turtle Emys trinacris (Testudines, Emydidae), an example of ‘parasite ine…

2016

The freshwater turtles of the genus Emys and some leech species of the family Glossiphoniidae are the only Palaearctic representatives of primarily Nearctic taxa, which jointly colonized Eurasia and the Maghreb during the Miocene. The strict trophic relationships occurring between the glossiphoniid parasite leech Placobdella costata and its host, the emydid Emys orbicularis, make them a prime example of host–parasite cophylogenetic evolution. In the light of the discovery of the Sicilian cryptic endemic species Emys trinacris, which is the sister species to the widespread Palaearctic E. orbicularis, the possible cophylogenetic divergence of the turtle hosts and their leech parasites was inv…

0106 biological sciences0301 basic medicineSettore BIO/05 - ZoologiaEmydidae010603 evolutionary biology01 natural scienceslaw.invention03 medical and health sciencesHost–parasite coevolutionlawGeneticsParasite hostingTurtle (robot)Molecular BiologyEcology Evolution Behavior and SystematicsbiologyHirudinea Placobdella costata Helobdella stagnalis host–parasite coevolutionPlacobdella costataEcologybiology.organism_classificationlanguage.human_language030104 developmental biologyEmys trinacrisHelobdella stagnalislanguageAnimal Science and ZoologySicilian
researchProduct

Echinoderm Antimicrobial Peptides

2016

Abstract Antimicrobial peptides (AMPs) are widely expressed in organisms and have been linked to innate and acquired immunity in vertebrates. These compounds are constitutively expressed from different cellular types to interact directly with infectious agents and/or modulate immunoreactions. In invertebrates, including echinoderms, which lack a vertebrate-type adaptive immune system, AMPs represent the major humoral defense system against infection, showing a diverse spectrum of action mechanisms, most of them related to plasma membrane disturbance and lethal alteration of microbial integrity. Here, we summarize the knowledge of AMPs in echinoderms as Strongylocins identified in the sea ur…

DeuterostomeImmune systemInnate immune systembiologyEchinodermHolothuria tubulosaAntimicrobial peptidesbiology.organism_classificationAcquired immune systemStrongylocentrotus purpuratusCell biology
researchProduct

In vitro effect of cadmium and copper on separated blood leukocytes of Dicentrarchus labrax.

2013

The immunotoxic effects of heavy metals on blood leukocytes of sea bass (Dicentrarchus labrax) were examined. The cells, separated by a discontinuous Percoll-gradients, were exposed in vitro to various sublethal concentrations of cadmium and copper (10(-7) M, 10(-5) M, and 10(-3) M) and their immunotoxic effect was then evaluated by measuring neutral red uptake, MU assay, DNA fragmentation and Hsp70 gene expression. First of all, we demonstrated that the cells treated in vitro could incorporate Cd and Cu. A relationship between heavy metal exposure and dose-time-dependent alterations in responses of leukocytes from blood was found for both metals, but copper was more immunotoxic than cadmiu…

MTTNeutral redMembrane permeabilityHealth Toxicology and MutagenesisSettore BIO/05 - Zoologiachemistry.chemical_elementNRchemistry.chemical_compoundReal-time-PCRLeukocytesAnimalsMTT assayHSP70 Heat-Shock ProteinsCytotoxicityCadmiumHeavy metal; Leukocytes; NR; MTT; Hsp70 gene; Real-time-PCRbiologyPublic Health Environmental and Occupational HealthGeneral MedicineLeukocytebiology.organism_classificationPollutionMolecular biologyIn vitroHeavy metalchemistryGene Expression RegulationNeutral RedImmunologyHsp70 geneDNA fragmentationDicentrarchusBassCopperWater Pollutants ChemicalCadmium
researchProduct

Cytotoxic activity of Holothuria tubulosa (Echinodermata) coelomocytes.

2017

Abstract The immune system of marine invertebrates, in particular that of holothurians, still requires further study. Our research showed that coelomocyte cells contained in the coelomic fluid of the sea cucumber, Holothuria tubulosa, are able to lyse, in vitro, red blood cells in rabbits and sheep. A plaque-forming assay showed spherule cells to be the effector cells, able to release cytotoxic molecules after xenogenic cell contact. The coelomocyte lysate supernatant, analysed by polyacrylamide gel electrophoresis overlay technique, using rabbit and sheep erythrocytes, showed two different haemolytic protein patterns: one calcium dependent and the other calcium independent. The fractions o…

0301 basic medicineLysisErythrocytesOverlay assayAquatic ScienceMicrobiologyLysis plaque assay03 medical and health sciencesSea cucumber0302 clinical medicineImmune systemLeukocytesEnvironmental ChemistryCytotoxic T cellAnimalsHolothuriaPolyacrylamide gel electrophoresisCoelomocyteSheepbiologyHolothuria tubulosaGeneral Medicinebiology.organism_classificationHolothuria tubulosaIn vitroImmunity InnateHaemolytic activity030104 developmental biologyBiochemistryElectrophoresis Polyacrylamide GelCoelomocyteRabbits030215 immunologyFishshellfish immunology
researchProduct

D-Galactose binding lectins from the tunicate Ascidiamalaca: Subunit characterization and hemocyte surface distribution

1988

Abstract D-galactose specific lectins purified from Ascidia malaca serum contain a major protein component with an apparent molecular weight of about 58,000 daltons, which moves more rapidly under non-reducing conditions. Intramolecular disulfide linkages can explain this behaviour, suggesting a compact protein structure. Membrane lectins have been demonstrated on the surface of about 34% hemocytes by immunofluorescent methods using a rabbit antiserum against the isolated serum lectins. Small, medium and large hemocytes can be positive, as also shown by binding on Sepharose spherules or by rosette formation with sheep and rabbit erythrocytes. Binding is inhibited by the same sugars specific…

Binding SitesBlood CellsHemocytesRosette FormationGalectinsProtein subunitCell MembraneImmunologyLectinBiologyBinding CompetitiveSepharosechemistry.chemical_compoundHemagglutininsProtein structurechemistryBiochemistryGalactoseGalactose bindingbiology.proteinAnimalsProtein quaternary structureUrochordataAntibodyDevelopmental BiologyDevelopmental &amp; Comparative Immunology
researchProduct

Spontaneous cytotoxic activity of eosinophilic granule cells separated from the normal peritoneal cavity ofDicentrarchus labrax

2000

Abstract In this study the spontaneous in vitro cytotoxic activity to tumour cell lines, (K562), by unstimulated sea bass ( Dicentrarchus labrax ) leukocytes was examined by trypan blue exclusion test and lactate dehydrogenase release assay. A high anti-tumour cell line activity of resident peritoneal leukocytes was found at an effector to target ratio (E:T) of 25:1 after incubation for 2 h at 18° C. Rabbit and sheep erythrocytes were not lysed. A low activity was displayed by head kidney and spleen cell populations whereas blood leukocytes revealed no significant activity. The effect of E:T ratio on cytotoxicity as well as microscopy observations suggested that the cytotoxic reaction requi…

Cytotoxicity ImmunologicPathologymedicine.medical_specialtySettore BIO/05 - ZoologiaCell SeparationAquatic SciencePeritoneal cavitychemistry.chemical_compoundLactate dehydrogenaseCentrifugation Density GradientTumor Cells CulturedmedicineAnimalsHumansEnvironmental ChemistryCytotoxic T cellCytotoxicityPeritoneal CavitybiologyOsmolar ConcentrationGranule (cell biology)Dicentrarchus labrax Teleostei cytotoxicity peritoneal cavity eosinophilic granule cellGeneral MedicineCytotoxicity Tests Immunologicbiology.organism_classificationMolecular biologyEosinophilsmedicine.anatomical_structurechemistryCell cultureBassDicentrarchusRabbitsPercollFish &amp; Shellfish Immunology
researchProduct

Fatty Acids and Triacylglycerols Profiles from Sicilian (Cold Pressed vs. Soxhlet) Grape Seed Oils

2021

Among the Sicilian economic productive sectors, that of wine production has today a considerable economic value. However, with the growth of this sector, notable was the increase in the production of waste, which to date is not only an economic damage for companies, but also a threat to the environment. It is known that waste from wine production has properties (e.g., antioxidants) which have potential reuse at cosmetic, pharmaceutical and nutritional levels to obtain economically sustainable applications. A new goal is given by the recovery of added value compounds from agri-food wastes and by-products. Grape seed oil is a promising vegetable fat and cold pressing does not involve the use …

food.ingredientSettore CHIM/10 - Chimica Degli AlimentiAnimal foodGeography Planning and DevelopmentTJ807-830Context (language use)Management Monitoring Policy and LawReuseTD194-195fatty acidsRenewable energy sourcesGrape seed oilfoodgrape seed oilSoxhlet extractionSettore CHIM/01 - Chimica AnaliticaGE1-350Grape seedPressingWinebiorefineryEnvironmental effects of industries and plantsRenewable Energy Sustainability and the Environmentcircular economyfood and beveragesBiorefineryPulp and paper industryEnvironmental sciencescold pressed extractionEnvironmental scienceSustainability
researchProduct

Prophenoloxidase activating system in tunicate hemolymph

1996

The activation sequence and related factors of the prophenoloxidase activating system in crustaceans was compared with the equivalent system in tunicates. Both solitary and colonial ascidians present in their hemolymph a copper-dependent phenoloxidase activity that may be inhibited by tropolone and phenylthiourea. Carbohydrates are able, to various extents, to trigger proPO system which requires serine protease cleavage for activation to phenoloxidase (PO). In some ascidians, hemocytes called ≪morula cells≫ show PO activity, while in Ciona intestinalis the ≪univacuolar refractile granulocytes≫ are positive after cytochemical staining with L-dopa. The relationships between proPO system and d…

Serine proteaseHemocytesanimal structuresbiologyEcologyfungiImmune responsesProphenoloxidaseTunicatebiology.organism_classificationTropoloneTunicatechemistry.chemical_compoundBiochemistrychemistryembryonic structuresHemolymphPhenoloxidasebiology.proteinCytotoxic T cellAnimal Science and ZoologyCiona intestinalisOpsonin
researchProduct

Cytotoxic Potential of the Coelomic Fluid Extracted from the Sea Cucumber Holothuria tubulosa against Triple-Negative MDA-MB231 Breast Cancer Cells

2019

Growing evidence has demonstrated that the extracts of different holothurian species exert beneficial effects on human health. Triple negative breast cancers (TNBC) are highly malignant tumors that present a poor prognosis due to the lack of effective targeted therapies. In the attempt to identify novel compounds that might counteract TNBC cell growth, we studied the effect of the exposure of the TNBC cell line MDA-MB231 to total and filtered aqueous extracts of the coelomic fluid obtained from the sea cucumber Holoturia tubulosa, a widespread species in the Mediterranean Sea. In particular, we examined cell viability and proliferative behaviour, cell cycle distribution, apoptosis, autophag…

0301 basic medicineautophagyCellSettore BIO/05 - ZoologiaBiologyGeneral Biochemistry Genetics and Molecular Biology03 medical and health sciences0302 clinical medicinebreast cancermitochondrial functionOrganellemedicineCytotoxic T cellViability assay<i>Holothuria tubulosa</i>Settore BIO/06 - Anatomia Comparata E Citologialcsh:QH301-705.5cell viabilityGeneral Immunology and MicrobiologyHolothuria tubulosaAutophagyCell cyclebiology.organism_classificationHolothuria tubulosa030104 developmental biologymedicine.anatomical_structurelcsh:Biology (General)Apoptosis030220 oncology & carcinogenesisCancer researchcell cycleGeneral Agricultural and Biological Sciencescoelomic fluid
researchProduct

The impact of climate change on Mediterranean intertidal communities: losses in coastal ecosystem integrity and services

2014

As has been shown for other ecosystems, the ecological and socio-economic impacts of climate change on Mediterranean intertidal habitats are highly variable in space and time. We conducted field and laboratory measurements of cellular, ecophysiological and behavioural responses of selected intertidal invertebrates (mussels, gastropods and sponges) and completed a literature review to determine what is known of socioeconomic consequences of these biological changes. Results suggest significant gaps in our knowledge that may impede a complete understanding of likely impacts (physical, biological, and socioeconomic) and that sufficient data for such an analysis is available only for mussels. A…

Settore BIO/07 - EcologiaGlobal and Planetary ChangeEcosystem serviceEcologyBioenergetic mechanistic modellingEcophysiologyMytilaster minimusInvasive specieIntertidal zoneClimate changeIntertidalIntertidal; Bioenergetic mechanistic modelling; Ecophysiology; Ecosystem services; Climate change; Invasive species; Mediterranean SeaIntroduced speciesIntertidal ecologyEcosystem servicesFisheryGeographyHabitatMediterranean SeaClimate changeEcosystemintertidal; bioenergetic mechanistic modelling; ecophysiology; ecosystem services; climate change; invasive species; Mediterranean Sea
researchProduct

Cell-Free Coelomic Fluid Extracts of the Sea Urchin Arbacia lixula Impair Mitochondrial Potential and Cell Cycle Distribution and Stimulate Reactive …

2020

Triple-negative breast cancer (TNBC) is a highly malignant tumor histotype which lacks effective targeted therapies, thereby being considered as the most aggressive form of breast carcinoma. To identify novel compounds which could counteract TNBC cell growth, we explored the in vitro effects of crude extracts and &lt

CellSettore BIO/05 - ZoologiaOcean Engineering03 medical and health scienceslcsh:Oceanography0302 clinical medicinebreast cancerlcsh:VM1-989biology.animalmedicineViability assaylcsh:GC1-1581Settore BIO/06 - Anatomia Comparata E CitologiaArbacia lixulaSea urchin030304 developmental biologyWater Science and TechnologyCivil and Structural Engineeringchemistry.chemical_classification0303 health sciencesReactive oxygen speciesbiologylcsh:Naval architecture. Shipbuilding. Marine engineeringCell cyclebiology.organism_classificationechinodermmedicine.anatomical_structurechemistryApoptosis030220 oncology & carcinogenesisCancer researchcytotoxicityBreast carcinomaJournal of Marine Science and Engineering
researchProduct

Sugar specific cellular lectins of Phallusia mamillata hemocytes: Purification, characterization and evidence for cell surface localization

1989

Cellular lectins (CLs) of Phallusia mamillata were demonstrated in protein preparations obtained by salt fractionation from hemocytes sonicated in a suitable medium. Since the lectins from the precipitated fraction bind sugars containing D-galactosyl groups, they were purified by affinity chromatography on Sepharose. SDS-PAGE under reducing conditions showed that CLs are formed of two components of apparent MWs approximately 36,900 and 35,090 and thus differ from serum lectins (SLs) (MW about 62,200). The "shrinkage" observed when SLs were examined under nonreducing conditions suggest the presence of intrachain disulphide bonds which can affect the molecular structure of the SLs. CL-SL diff…

PhallusiaHemocytesImmunologyLactoseHemocyteImmunoelectrophoresisTunicateChromatography AffinitySepharoseAffinity chromatographyLectinsmedicineAnimalsUrochordatachemistry.chemical_classificationGel electrophoresisBlood Cellsbiologymedicine.diagnostic_testCell MembraneLectinHemagglutination Inhibition Testsbiology.organism_classificationImmunodiffusionMolecular WeightchemistryBiochemistrybiology.proteinGlycoproteinLectinDevelopmental Biology
researchProduct

The gelatinase MMP-9like is involved in regulation of LPS inflammatory response in Ciona robusta

2019

Matrix metalloproteinases (MMPs) are a family of endopeptidases collectively able to degrade the components of the extracellular matrix (ECM), with important roles in many biological processes, such as embryogenesis, normal tissue remodelling, angiogenesis and wound healing. New views on the function of MMPs reveal that they regulate inflammatory response and therefore might represent an early step in the evolution of the immune system. MMPs can affect the activity of cytokines involved in inflammation including TGF-β and TNF-α. MMPs are widely distributed in all kingdoms of life and have likely evolved from a single-domain protein which underwent successive rounds of duplications. In this …

0301 basic medicineLipopolysaccharidesModels MolecularAngiogenesisSettore BIO/05 - ZoologiaInflammationAquatic ScienceMatrix metalloproteinaseExtracellular matrixCiona robustaMatrix metalloproteinases (MMPs)MMP-2MMP-9PharynxInflammationLPS03 medical and health sciencesDownregulation and upregulationTransforming Growth Factor betamedicineEnvironmental ChemistryGelatinaseAnimalsCiona intestinalisPhylogenyInflammationbiologyTumor Necrosis Factor-alphafungi04 agricultural and veterinary sciencesGeneral Medicinebiology.organism_classificationMatrix MetalloproteinasesCell biologyCiona intestinalis030104 developmental biologyGelatinases040102 fisheries0401 agriculture forestry and fisheriesmedicine.symptomWound healing
researchProduct

Phenoloxidase-dependent cytotoxic mechanism in ascidian (Styela plicata) hemocytes active against erythrocytes and K562 tumor cells.

1997

The cytotoxic activity against rabbit erythrocytes (RE) and human K562 tumor cells by Styela plicata hemocytes was significantly related to the phenoloxidase (PO) which converts phenols to quinone and initiates the melanogenic pathway. The effector hemocyte population, separated in a Percoll density gradient band, enriched in a granulocyte type named "morula cells", was examined with RE in a hemocyte cytotoxic assay and plaque forming cell assay. Inhibition experiments with the copper chelating agents 1-phenyl-2-thiourea and tropolone, the substrate analogue sodium benzoate and sodium ascorbate support the notion that hemocyte cytotoxic activity is a PO-dependent mechanism. Treatments of he…

ErythrocytesHemocytesMonophenol MonooxygenaseCytotoxicitySettore BIO/05 - ZoologiaHemocyteHydrogen PeroxideTunicateCell FractionationNitric OxidePhenylthioureaTropoloneErythrocytePhenoloxidaseCentrifugation Density GradientTumor Cells CulturedAnimalsHumansQuinoneRabbitsUrochordataK562Settore BIO/06 - Anatomia Comparata E CitologiaReactive Oxygen SpeciesEuropean journal of cell biology
researchProduct

Hemocytes of Rhynchophorus ferrugineus (Olivier)(Coleoptera: Curculionidae) and their response to Saccharomyces cerevisiae and Bacillus thuringiensis

2011

Originally from tropical Asia, the Red Palm Weevil (RPW Rhynchophorus ferrugineus (Olivier) is the most dangerous and deadly pest of many palm trees, and there have been reports of its recent detection in France, Greece and Italy. At present, emphasis is on the development of integrated pest management based on biological control rather than on chemical insecticides, however the success of both systems is often insufficient. In this regard, RPW appears to be one pest that is very difficult to control. Thus inves- tigations into the natural defences of this curculionid are advisable. RPW hemocytes, the main immuno- competent cells in the insect, are described for the first time. We identifie…

HemocytesRed Palm Weevil Infection Insect immunity Hemolymph Biological controlBacillus thuringiensisBiological pest controlSettore BIO/05 - ZoologiaSaccharomyces cerevisiaeBiologyMicrobiologyPhagocytosisHemolymphBacillus thuringiensisBotanyHemolymphAnimalsPest Control BiologicalEcology Evolution Behavior and SystematicsLarvaWeevilfungibiology.organism_classificationBlood Cell CountBiopesticideRhynchophorusSettore AGR/11 - Entomologia Generale E ApplicataLarvaHost-Pathogen InteractionsWeevilsPEST analysis
researchProduct

Modulation of immune responses of Rhynchophorus ferrugineus (Insecta: Coleoptera) induced by the entomopathogenic nematode Steinernema carpocapsae (N…

2014

Aim of this study was to investigate relationships between the red palm weevil (RPW) Rhynchophorus ferrugineus (Olivier) and the entomopathogenic nematode Steinernema carpocapsae (EPN); particularly, the work was focused on the immune response of the insect host in naive larvae and after infection with the EPN. Two main immunological processes have been addressed: the activity and modulation of host prophenoloxidase-phenoloxidase (proPO) system, involved in melanization of not-self and hemocytes recognition processes responsible for not-self encapsulation. Moreover, immune depressive and immune evasive strategies of the parasite have been investigated. Our results suggest that RPW possess a…

Encapsulation; Immune depression; Immune evasion; ProPO system; Rhynchophorus ferrugineus; Steinernema carpocapsae;Immune depressionEnzyme PrecursorsImmunity CellularHemocytesImmune evasionProPO systemSettore BIO/05 - ZoologiaRhynchophorus ferrugineusHost-Parasite InteractionsImmunity HumoralColeopteraRhabditidaSettore AGR/11 - Entomologia Generale E ApplicataLarvaAnimalsEncapsulationSettore BIO/06 - Anatomia Comparata E Citologiaencapsulation Immune depression Immune evasion proPO system Rhynchophorus ferrugineus Steinernema carpocapsaeSteinernema carpocapsaeCatechol Oxidase
researchProduct

Chromosome studies in North-Western Sicily males of Rhynchophorus ferrugineus

2016

Rhynchophorus ferrugineus (Olivier), known as red palm weevil (RPW) was accidentally introduced and established in Sicily (Italy) since 2005. As like in other Mediterranean sites, RPW has been causing extensive damage to palm trees and on its new host Phoenix canariensis Chabaud (Canary Island palms), acquired concomitantly with the colonization of the area. RPW shows a good ecological plasticity and slightly but significant morphological polymorphism (colour patterns and length of the rostrum in male individuals) that can be appreciated within different geographical populations. The aim of the present work was to investigate if this ecological plasticity and phenotypic variability can be a…

Alternative host plant; Invasive specie; Karyotype; Polymorphisms; Red palm weevil; Insect ScienceSettore AGR/11 - Entomologia Generale E ApplicataInsect ScienceKaryotypeInvasive specieSettore BIO/05 - ZoologiaPolymorphismRed palm weevilAlternative host plant
researchProduct

Aroclor 1254 inhibits the chemiluminescence response of peritoneal cavity cells from sharpsnout sea bream (Diplodus puntazzo)

2014

Chronic exposure to polychlorinated biphenyls (PCBs) affect the immune system of fish and could lead to a decreased disease resistance. The effects of Aroclor 1254, PCB mixtures, on the Diplodus puntazzo innate immunity were examined by assaying the zymosan stimulated chemiluminescence response (CL) of peritoneal cavity cells (PCCs) at various times (1, 24, 48 h and 1-4 weeks) from intraperitoneal injection of the xenobiotic (1 mg kg(-1) body weight). Controls were performed by assaying cells from medium-treated fish. Since the kinetic of the chemiluminescence response showed the highest peak at 25 min after the zymosan stimulation of the cells, the values found at that time were considered…

Respiratory burstmedicine.medical_specialtyPhagocytemedicine.medical_treatmentIntraperitoneal injectionSettore BIO/05 - ZoologiaImmunotoxicologyAquatic ScienceBiologychemistry.chemical_compoundPeritoneal cavityPhagocytosisInternal medicineAroclor 1254medicineAnimalsEnvironmental ChemistryPeritoneal CavityPhagocytesInnate immune systemDiplodus puntazzoZymosanGeneral MedicineChlorodiphenyl (54% Chlorine)Peritoneal cavity cellsImmunity InnatePerciformesRespiratory burstEndocrinologymedicine.anatomical_structurechemistryLuminescent MeasurementsChemiluminescence responseXenobioticInjections IntraperitonealDiplodus puntazzo; Aroclor 1254; Chemiluminescence response; Respiratory burst; Peritoneal cavity cells
researchProduct

Impact of Heavy Metals in Eggs and Tissues of C. caretta along the Sicilian Coast (Mediterranean Sea)

2022

In this study we compared the heavy metal concentration found in different tissues and eggs of the loggerhead sea turtle and evaluated the potential ecotoxicological risk for this important species. Eighteen heavy metal elements were determined in different tissues (liver, gonads, fat, kidney, heart, brain, and spleen) of nine individuals of Caretta caretta found stranded along the coasts of Messina (Sicily, Italy) and in the shell and yolk of six eggs from the island of Linosa (Sicily, Italy). For the analysis of the heavy metals, we used the analytical procedures in accordance with the EPA 200.8 method supplemented by EPA 6020b with three replicates for each measurement. The elements anal…

Settore BIO/07 - Ecologialoggerhead sea turtleCaretta carettaRenewable Energy Sustainability and the EnvironmentMediterranean seaSettore BIO/05 - Zoologiaheavy metalloggerhead sea turtle; <i>Caretta caretta</i>; marine pollution; heavy metals; biodistribution; Mediterranean seabiodistributionEcology Evolution Behavior and SystematicsSettore CHIM/12 - Chimica Dell'Ambiente E Dei Beni CulturaliGeneral Environmental Sciencemarine pollution
researchProduct

Chitosan Film Functionalized with Grape Seed Oil—Preliminary Evaluation of Antimicrobial Activity

2022

Although the fishing and wine industries undoubtedly contribute significantly to the economy, they also generate large waste streams with considerable repercussions on both economic and environmental levels. Scientific literature has shown products can be extracted from these streams which have properties of interest to the cosmetics, pharmaceutical and food industries. Antimicrobial activity is undoubtedly among the most interesting of these properties, and particularly useful in the production of food packaging to increase the shelf life of food products. In this study, film for food packaging was produced for the first time using chitosan extracted from the exoskeletons of red shrimp (Ar…

Settore CHIM/10 - Chimica Degli AlimentiRenewable Energy Sustainability and the EnvironmentGeography Planning and DevelopmentSettore BIO/05 - Zoologiafood and beveragesSettore MED/10 - Malattie Dell'Apparato RespiratorioManagement Monitoring Policy and Lawbioactive molecule; crustacean; marine invertebrate; shelf lifebioactive moleculemarine invertebrateSettore CHIM/03 - Chimica Generale E Inorganicashelf lifecrustaceanSettore BIO/06 - Anatomia Comparata E CitologiaSettore AGR/16 - Microbiologia AgrariaSustainability
researchProduct

Noise elicits hematological stress parameters in Mediterranean damselfish (Chromis chromis, perciformes): A mesocosm study

2017

In the last few decades, technological developments and the widespread rise of anthropic activities have increased the exposure of organisms to noise pollution, thus evoking great interest in its biological effects, particularly on the immune system. The aim of the present work was to investigate some of the biochemical parameters in the blood of Chromis chromis (Linnaeus, 1758) following in vivo exposure to noise levels of 200 and 300 Hz. Our results revealed that, compared to the control specimens, the fish exposed to noise had significantly increased levels of stress biomarkers such as glucose, lactate and total proteins in plasma, as well as a rise in the expression of heat shock protei…

0106 biological sciences0301 basic medicineMediterranean climateBlood GlucoseStreZoologyAquatic Science01 natural sciencesPerciformesMesocosm03 medical and health sciencesRandom AllocationBlood ProteinNoise pollutionStress PhysiologicalAnimalsEnvironmental ChemistryHSP70 Heat-Shock ProteinsLactic AcidDamselfishPerciformeHSP70HSP70 Heat-Shock ProteinbiologyNoise pollutionEcologyAnimal010604 marine biology & hydrobiologyAquatic animalGeneral MedicineBlood Proteinsbiology.organism_classificationChromis chromisHsp70Perciformes030104 developmental biologyBloodChromis chromiNoise
researchProduct

Immunological Activity of Ascidian Hemocytes

2001

In ascidians, various hemocyte types and their differentiation stages may be responsible for several immune functions. A central role in the immune effector mechanisms can be assigned to PO-containing hemocytes and prophenoloxidase system. Morula cell in Styela plicata and univacuolar refringent granulocyte in Ciona intestinalis, a probable intermediate stages in the differentiation pathway of morula cell, may be cytotoxic cells. They are involved in immune reactions of solitary and colonial ascidians. We have shown that they are provided with a PO-linked spontaneous cytotoxic activity and recognize mammalian erythrocytes or tumor cells markers. The toxic molecules can be radical oxygen int…

biologyCellProphenoloxidaseBotryllus schlosseribiology.organism_classificationCell biologymedicine.anatomical_structureStyela plicataImmune systemembryonic structuresImmunologymedicineCytotoxic T cellCiona intestinalisCytotoxicity
researchProduct

3-(6-Phenylimidazo [2,1-b][1,3,4]thiadiazol-2-yl)-1H-Indole Derivatives as New Anticancer Agents in the Treatment of Pancreatic Ductal Adenocarcinoma

2020

A new series of imidazo[2,1-b][1,3,4]thiadiazole derivatives was efficiently synthesized and screened for their in vitro antiproliferative activity on a panel of pancreatic ductal adenocarcinoma (PDAC) cells, including SUIT-2, Capan-1 and Panc-1. Compounds 9c and 9l, showed relevant in vitro antiproliferative activity on all three pre-clinical models with half maximal inhibitory concentration (IC50) ranging from 5.11 to 10.8 &micro

antiproliferative activityPancreatic ductal adenocarcinomaendocrine system diseasespancreatic cancerPharmaceutical ScienceImidazo[21-b][134]thiadiazole derivativeAnalytical Chemistryresistancelcsh:QD241-44103 medical and health sciences0302 clinical medicinelcsh:Organic chemistryPancreatic cancerDrug DiscoverymedicinePhysical and Theoretical ChemistryIC50imidazo[21-<i>b</i>][134]thiadiazole derivatives030304 developmental biologyIndole test0303 health sciencesmigration assayMigration AssayChemistryOrganic ChemistryBiological activityindole compoundsmedicine.diseaseIn vitrodigestive system diseasesIndole compoundChemistry (miscellaneous)Cell culture030220 oncology & carcinogenesisCancer researchMolecular Medicine
researchProduct

Cadmium, Copper and Tributyltin effects on fertilization of Paracentrotus lividus (Echinodermata)

2009

Marine environments are continuously being threatened by a large number of xenobi- otics from anthropogenic sources. The effect of chemical pollution on living organisms are numerous and may impair reproductive success of adults species of marine invertebrate and vertebrate through effects on gamete quality. Echinoderms are characterized by external fertilizzation and gametes, free of any type of protection, may be in contact with toxic substances so the reproductive success depends largely on the environment conditions. The purpose of this work is to assess the effects on the in vitro fertiliza- tion of exposure of sea urchin Paracentrotus lividus gametes to xenobiotic substances as CuSO4,…

040301 veterinary sciencesSettore BIO/05 - ZoologiaZoologyParacentrotus lividus0403 veterinary scienceToxicologychemistry.chemical_compoundHuman fertilizationbiology.animalmedicineSea urchinlcsh:SF1-1100biology0402 animal and dairy science04 agricultural and veterinary sciencesMarine invertebratesbiology.organism_classification040201 dairy & animal scienceSpermmedicine.anatomical_structurechemistryParacentrotus lividusParacentrotus lividus Cadmium Copper TBT Embryotoxicity BiomarkerTributyltinGameteAnimal Science and Zoologylcsh:Animal cultureXenobioticCadmium
researchProduct

In vitro release of lectins by Phallusia mamillata hemocytes.

1991

Abstract α-Lactose specific lectins are released from Phallusia mamillata hemocytes during short-term cultures. The molecular weight of the subunits, the immunological cross-reaction and the sugar specificity suggest that the released lectins are similar to those isolated from the sonicated hemocytes. Because lectin release appears to take place independently of active protein synthesis, the possibility exists that lectins are pre-formed, stored in hemocytes and released when in vitro conditions stimulate the cells.

PhallusiaAmanitinsHemocytesHemocyteImmunologyBiologyTunicateLectinsAnimalsUrochordataCycloheximideCells Culturedchemistry.chemical_classificationLectinActive proteinbiology.organism_classificationIn vitroCulture MediaBiochemistrychemistryReleasebiology.proteinDactinomycinLiberationGlycoproteinSecretory RateLectinDevelopmental BiologyDevelopmental and comparative immunology
researchProduct

New distributional data on &lt;em&gt;Haemogregarina stepanowi&lt;/em&gt; (Apicomplexa) and &lt;em&gt;Placobdella costata&lt;/em&gt; (Hirudinea) paras…

2021

The host-parasite system “Emys trinacris – Placobdella costata – Haemogregarina stepanowi” is known for Sicily, but scarce information is available to date about the distribution of the two parasites on the island. Therefore, an extensive sampling effort through visual census and collection and analysis of blood smears of the endemic Sicilian pond turtle E. trinacris was carried out in 46 water bodies scattered throughout mainland Sicily. Our findings revealed that the distribution of both parasites is limited to the Nebrodi area, where the infection of H. stepanowi has shown a high incidence on the local turtle populations. Our data suggest no correlation between the current distribution o…

biologyHost (biology)PaleontologyZoologyGeologyPlant ScienceEmydidaebiology.organism_classificationlanguage.human_languagelaw.inventionColonisationEmys trinacrislawlanguageGlossiphoniidaeParasite hostingAnimal Science and ZoologyTurtle (robot)SicilianEcology Evolution Behavior and SystematicsNatural History Sciences
researchProduct

Fragments of β-thymosin from the sea urchinParacentrotus lividusas potential antimicrobial peptides against staphylococcal biofilms

2012

The immune mediators in echinoderms can be a potential source of novel antimicrobial peptides (AMPs) applied toward controlling pathogenic staphylococcal biofilms that are intrinsically resistant to conventional antibiotics. The peptide fraction <5 kDa from the cytosol of coelomocytes of the sea urchin Paracentrotus lividus (5-CC) was tested against a group of Gram-positive and Gram-negative pathogen reference strains. The 5-CC of P. lividus was active against all planktonic-tested strains but also showed antibiofilm properties against staphylococcal strains. Additionally, we demonstrated the presence of three small peptides in the 5-CC belonging to segment 9-41 of a P. lividusβ-thymosin. T…

chemistry.chemical_classificationbiologymedicine.drug_classGeneral NeuroscienceAntimicrobial peptidesAntibioticsThymosinBiofilmPeptidebiology.organism_classificationGeneral Biochemistry Genetics and Molecular BiologyParacentrotus lividusMicrobiologyHistory and Philosophy of Sciencechemistrybiology.animalmedicineSea urchinPathogenAnnals of the New York Academy of Sciences
researchProduct

Phenoloxidases in ascidian hemocytes: characterization of the pro-phenoloxidase activating system.

2003

The phenoloxidase (PO) activity of the hemocytes lysate supernatant from three ascidians species, assayed by means of 3-methyl-2-benzothiazolinone hydrazone hydrochloride, have been compared. PO-containing hemocytes were identified by a cytochemical reaction and the enzymatic activity measured by a spectrophotometric assay of lysate supernatant from hemocyte populations separated on a discontinuous Percoll density gradient. In Styela plicata, the enzyme appeared to be contained in morula cells only. In Ciona intestinalis, PO activity was shown in univacuolar refractile granulocyte and granular hemocyte. In Phallusia mammillata both compartment cell and granular hemocytes were positive. Enzy…

LysisHemocytesCiona intestinaliCell separationPhysiologySettore BIO/05 - ZoologiaHemocyteBiologyTunicateBiochemistryEnzyme activatormedicineAnimalsCiona intestinalisPhallusia mammillataBenzothiazolesUrochordataMolecular BiologyPolyacrylamide gel electrophoresischemistry.chemical_classificationMonophenol MonooxygenaseImmunityHydrazonesTrypsinbiology.organism_classificationMolecular biologyEnzyme ActivationThiazolesEnzymeStyela plicatachemistryStyela plicataPhenoloxidasePercollmedicine.drugComparative biochemistry and physiology. Part B, Biochemistrymolecular biology
researchProduct

The good, the bad and the ugly: Emys trinacris, Placobdella costata and Haemogregarina stepanowi in Sicily (Testudines, Annelida and Apicomplexa)

2016

Endemic Sicilian pond turtles Emys trinacris Fritz, Fattizzo, Guicking, Tripepi, Pennisi, Lenk, Joger et Wink were examined for the presence of haemogregarine parasites. The presence of haemogregarines, occurring mainly in the microgametocyte stage (13.2 ± 0.12 μm in length and 6.4 ± 0.52 μm in width), was observed in approximately 9% of the sampled E. trinacris. Based on the observed morphology and on the sequencing of nuclear 18S rDNA, we identified the parasite as Haemogregarina stepanowi Danilewsky, 1885. Morphometric study of uninfected and infected red blood cells has shown that H. stepanowi induces different changes in erythrocyte shape depending on the infective stage. The different…

0106 biological sciences0301 basic medicineHaemogregarina stepanowiSettore BIO/05 - ZoologiaZoology010603 evolutionary biology01 natural sciencesApicomplexa03 medical and health scienceshaemoprotozoanEucoccidiidaLeechesparasite spill-overRNA Ribosomal 18SAnimalsParasite hostingSicilyPhylogenyEmysbiologyEmys orbicularisItaly; blood parasitism; conservation.; haemoprotozoans; parasite spill-overCoccidiosisEcologyTurtle (syntax)biology.organism_classificationlanguage.human_languageTurtles030104 developmental biologyItalyEmys trinacrisblood parasitismlanguageParasitologyconservation.Sicilian
researchProduct

In Vitro Release of Lectins From Phallusia mamillata Hemocytes After Their Fractionation on a Density Gradient

1993

Hemocytes were fractionated by centrifugation on a discontinuous Percoll density gradient from the hemolymph of Phallusia mamillata. Results obtained from microcultures of the fractionated hemocytes, sugar-inhibition experiments, SDS-PAGE, and immunoblotting indicate that “compartment cells” release cellular-type (CL) lectins that are specific for α-lactose and lactulose. The released lectins have the same properties as the CL lectins that were previously isolated from sonicated unfractionated hemocytes, but they differ in terms of some molecular and immunological properties from the lectins (SL) purified from the serum. SLs were never found in the supernatants from microcultures of the fra…

PhallusiabiologyDensity gradientfungiLectinGeneral MedicineFractionationbiology.organism_classificationMolecular biologyIn vitroHemolymphbiology.proteinAnimal Science and ZoologyCentrifugationTunicate hemocyte cells populationPercoll
researchProduct

Circulating hemocytes and pharyngeal explants of Styela clava release hemagglutinin in vitro

1997

Tunicate blood cells are a mixed population, thus experiments that assay their immunodefense responses, such as release of hemagglutinins, were done to isolate different functional hemocytic types. Two sources of hemocytes from Styela clava were used, the hemolymph and the pharynx (the hemopoietic organ). Hemolymph centrifuged through a discontinuous Percoll gradient yielded four distinct bands of hemocytes. After incubation at 15°C, circulating hemocytes and those from pharyngeal cultures released hemagglutinin after 2 and 30 days. Highest titers were found in B1 (hyaline and compartment cells), B3 (hyaline cells and eosinophil granulocytes), and B4 (hyaline cells and debris). Hemagglutina…

Styela clavaSettore BIO/05 - ZoologiaHemocyteSettore BIO/06 - Anatomia Comparata E CitologiaTunicate
researchProduct

Enhanced expression of a cloned and sequenced Ciona intestinalis TNFa-like (CiTNFa) gene during the LPS-induced inflammatory response.

2008

A tumor necrosis factor-alpha (TNFalpha)-like gene from Ciona intestinalis (CiTNF alpha-like) body wall challenged with bacterial lipopolysaccharide (LPS) was cloned and sequenced 4 h after LPS inoculation. An open reading frame of 936 bp encoding a propeptide of 312 amino acids (35.4 kDa) displaying a transmembrane domain from positions 7 to 29, a TACE cleavage site, and a mature peptide domain of 185 amino acids (20.9 kDa), was determined with a predicted isoelectric point of 9.4. The phylogenetic tree based on deduced amino acid sequences of invertebrate TNF-like protein and vertebrate TNFs supported the divergence between the ascidian and vertebrate TNF families, whereas D. melanogaster…

LipopolysaccharidesHemocytesHistologyMolecular Sequence DataSettore BIO/05 - ZoologiaGene ExpressionPathology and Forensic MedicineWestern blotGene expressionHemolymphmedicineTNFα . CiTNFα-like . CiTNFα-like expression . Inflammatory response . Pharynx . Hemocytes . Ciona intestinalis (Tunicata)AnimalsCiona intestinalisAmino Acid SequenceCloning MolecularPeptide sequencePhylogenyInflammationchemistry.chemical_classificationBase Sequencebiologymedicine.diagnostic_testTumor Necrosis Factor-alphaCell Biologybiology.organism_classificationMolecular biologyCiona intestinalisAmino acidTransmembrane domainOpen reading framechemistrySequence Alignment
researchProduct

Inhibitory activity of sphingomyelin on hemolytic activity of coelomic fluid of Holothuria polii (echinodermata)

1987

Abstract The hemolytic activity of coelomic fluid from Holothuria polii is specifically inhibited by sphingomyelin. This phospholipid is the constituent of the membrane which probably interacts with the hemolysin thereby leading to the lysis.

ErythrocytesLysisSea CucumbersImmunologyPhospholipidSettore BIO/05 - ZoologiaInhibitory postsynaptic potentialHemolysisMicrobiologychemistry.chemical_compoundmedicineAnimalsPhospholipidsComplement Inactivator ProteinsBacteriabiologyHemolysinbiology.organism_classificationBody FluidsSphingomyelinsRed blood cellCholesterolSphingomyelin Phosphodiesterasemedicine.anatomical_structurechemistryBiochemistryCoelomlipids (amino acids peptides and proteins)SphingomyelinHolothuriaEchinodermataDevelopmental Biology
researchProduct

Human Drug Pollution in the Aquatic System: The Biochemical Responses of Danio rerio Adults

2021

Simple Summary The release of medicinal products for human use in the aquatic environment is now a serious problem, and can be fatal for the organisms that live there. Danio rerio is a freshwater fish that provides the possibility to study the effects of these pollutants on the health of aquatic organisms. The results of the various existing scientific studies are scarce and conflicting. Here, we review the scientific studies that have analyzed these effects, highlighting that the impacts of drugs are evident in the biochemical responses of these animals. Abstract To date, drug pollution in aquatic systems is an urgent issue, and Danio rerio is a model organism to study the toxicological ef…

PollutantPollutionoxidative streGeneral Immunology and MicrobiologybiologyQH301-705.5media_common.quotation_subjectDanioReviewcortisolbiology.organism_classificationzebrafishGeneral Biochemistry Genetics and Molecular Biologyimmune responseenzymeDrug concentrationpharmaceutically active compounds (PhAC)Environmental healthoxidative stressDrug pollutionBiology (General)General Agricultural and Biological SciencesTotal proteinmedia_commonBiology
researchProduct

New Bioactive Peptides from the Mediterranean Seagrass Posidonia oceanica (L.) Delile and Their Impact on Antimicrobial Activity and Apoptosis of Hum…

2023

The demand for new molecules to counter bacterial resistance to antibiotics and tumor cell resistance is increasingly pressing. The Mediterranean seagrass Posidonia oceanica is considered a promising source of new bioactive molecules. Polypeptide-enriched fractions of rhizomes and green leaves of the seagrass were tested against Gram-positive (e.g., Staphylococcus aureus, Enterococcus faecalis) and Gram-negative bacteria (e.g., Pseudomonas aeruginosa, Escherichia coli), as well as towards the yeast Candida albicans. The aforementioned extracts showed indicative MIC values, ranging from 1.61 &mu;g/mL to 7.5 &mu;g/mL, against the selected pathogens. Peptide fractions were further analyzed thr…

antibiotic resistanceantimicrobial peptideOrganic ChemistryGeneral Medicineantibiotic resistance; drug-resistant bacteria; antimicrobial peptides; anticancer peptides; marine seagrasses; computational peptide designCatalysisanticancer peptideComputer Science ApplicationsInorganic Chemistrymarine seagrassedrug-resistant bacteriaPhysical and Theoretical Chemistrycomputational peptide designMolecular BiologySpectroscopyInternational Journal of Molecular Sciences
researchProduct

Cellular responses and HSP70 expression during wound healing in Holothuria tubulosa (Gmelin, 1788).

2014

Wound repair is a key event in the regeneration mechanisms of echinoderms. We studied, at the behavioural, cellular and molecular levels, the wound healing processes in Holothuria tubulosa after injuries to the body wall. The experiments were performed for periods of up to 72 h, and various coelomocyte counts, as well as the expression of heat shock proteins (HS27, HSP70 and HSP90), were recorded. Dermal wound healing was nearly complete within 72 h. In the early stages, we observed the injured animals twisting their bodies to keep their injuries on the surface of the water for the extrusion of the buccal pedicles. At the cellular level, we found time-dependent variations in the circulating…

HolothurianStreImmunoblottingSettore BIO/05 - ZoologiaHSP27 Heat-Shock ProteinsAquatic ScienceAndrologyWestern blotHeat shock proteinmedicineHSPEnvironmental ChemistryAnimalsHolothuriaHSP70 Heat-Shock ProteinsHSP90 Heat-Shock ProteinsSettore BIO/06 - Anatomia Comparata E CitologiaCoelomocyteWound Healingmedicine.diagnostic_testbiologyRegeneration (biology)Holothuria tubulosaGeneral Medicinebiology.organism_classificationHsp70Organ SpecificityImmunologyCoelomocyteWound healingHolothuriaFishshellfish immunology
researchProduct

Mercury in fish products: what’s the best for consumers between bluefin tuna and yellowfin tuna?

2017

A total of 205 bluefin and yellowfin tuna samples were examined for mercury detection in order to verify possible differences and have a detailed risk assessment of the two tuna species. The results showed significant higher mercury concentration in muscle tissue of bluefin tuna respect yellowfin tuna (p &lt; 0.001) with mean concentration of 0.84 mg/kg and maximum value of 1.94 mg/kg. These differences can be due the different biological and ecological aspects of the two tuna species and to different oceanographic aspects between Atlantic Ocean and Mediterranean sea. The results obtained in this study suggest an advisable containment of the sources of pollution and further studies on the c…

Yellowfin tunachemistry.chemical_elementFood ContaminationPlant ScienceRisk Assessment01 natural sciencesBiochemistryAnalytical Chemistrybluefin tuna; fish products; heavy metals; Mercury; mercury direct analyser; yellowfin tuna; Analytical Chemistry; Biochemistry; Plant Science; Organic ChemistryPlant scienceMediterranean seaFish Productsfish productMediterranean SeaAnimalsHumansAtlantic OceanbiologyMercury in fishTuna010405 organic chemistryMusclesOrganic Chemistrymercury direct analyseryellowfin tunafood and beveragesHeavy metalsEnvironmental ExposureMercuryheavy metalbiology.organism_classificationFish products0104 chemical sciencesMercury (element)Fishery010404 medicinal & biomolecular chemistrychemistrybluefin tunaEnvironmental scienceTunahuman activitiesFood AnalysisWater Pollutants Chemical
researchProduct

HPLC/HRMS and GC/MS for Triacylglycerols Characterization of Tuna Fish Oils Obtained from Green Extraction

2023

Background: Fish oil is one of the most common lipidic substances that is consumed as a dietary supplement. The high omega-3 fatty acid content in fish oil is responsible for its numerous health benefits. Fish species such as mackerel, herring, tuna, and salmon are particularly rich in these lipids, which contain two essential omega-3 fatty acids, known as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Objectives: Due to the scarcity of information in the literature, this study aimed to conduct a qualitative and quantitative characterization of triglycerides (TAGs) in crude tuna fish oil using HPLC/HRMS. Fatty acid (FA) determination was also performed using GC/MS. The tuna fis…

tuna oil; triglycerides; fatty acids; FAMEs; PUFAs; mass spectrometry; accurate mass; omega-3 supplementstuna oilHealth (social science)Settore CHIM/10 - Chimica Degli AlimentiSettore BIO/05 - ZoologiaPlant ScienceHealth Professions (miscellaneous)MicrobiologyFAMEomega-3 supplementsaccurate maSettore CHIM/01 - Chimica Analiticatriglyceridefatty acidSettore BIO/06 - Anatomia Comparata E CitologiaPUFAFood Sciencemass spectrometry
researchProduct

Cytotoxic activity of Ciona intestinalis (Tunicata) hemocytes: Properties of the in vitro reaction against erythrocyte targets

1993

Hemocytes (effectors) of Ciona intestinalis showed a natural cytotoxic capacity (HCA) when assayed in vitro against erythrocytes (targets). Cytotoxic cells lysed, to a variable extent, rabbit (RE), human (A, B, O), guinea pig, and sheep (SE) erythrocytes. Hemocyte cytotoxic activity (HCA) assayed against SE is a calcium-dependent reaction, occurs rapidly (15-30 min), at 25-37 degrees C over a wide range of pH (5.4-8.0). Assays were carried out using: 1) the medium in which hemocytes were maintained, 2) the soluble portion of hemocyte lysates, and 3) debris prepared from hemocyte lysates. Results suggest that HCA is a cell-mediated process that requires effector-target cell contacts. Anti-SE…

Cytotoxicity ImmunologicErythrocytesHemocytesLysisCiona intestinaliCytotoxicityHemolysinImmunologyCellHemocyteTunicateHemolymphmedicineAnimalsCytotoxic T cellCiona intestinalisInvertebrateCytotoxicitySheepbiologyHemolysinHemagglutination Testsbiology.organism_classificationMolecular biologyIn vitroCiona intestinalisRed blood cellmedicine.anatomical_structureImmunologySheep erythrocyteDevelopmental BiologyDevelopmental &amp; Comparative Immunology
researchProduct

Polyphenol Characterization and Antioxidant Activity of Grape Seeds and Skins from Sicily: A Preliminary Study

2022

The interest in the consumption of health-promoting foods has led to identifying derivatives of the wine industry as products to increase the functional properties of different foods or to design new functional foods. The main goal of this study is to characterize and valorize byproducts and wastes of Sicilian grapes as new sources of bioactive components, from the perspective of a circular economy and a biorefinery approach. In particular, this research investigated: 1. the total phenolic content and antioxidant activities and 2. the phenolic profiles of free and bound fractions of defatted grape seeds and red grape skins from Sicily. Defatted grape seeds (DGS) and red grape skins (RGSK) a…

grape seedswaste valorizationRenewable Energy Sustainability and the EnvironmentphenolicsGeography Planning and DevelopmentManagement Monitoring Policy and Lawradical scavenging activitywinemaking waste; grape seeds; grape skins; phenolics; anthocyanins; radical scavenging activity; waste valorizationanthocyaninswinemaking wastegrape skins
researchProduct

Sphingomyelin inhibition of Ciona intestinalis (Tunicata) cytotoxic hemocytes assayed against sheep erythrocytes

1995

Hemocytes from the ascidian, Ciona intestinalis, are capable of lysing erythrocytes in vitro following cell membrane contact. With the aim of examining the mechanism of cytotoxicity, we performed inhibition experiments with lipid components of erythrocyte membranes. Cholesterol is not an inhibitor, whereas, among the phospholipids tested, (sphingomyelin, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine) sphingomyelin inhibits the hemolytic activity of hemocytes. However, thin layer chromatography showed that sphingomyelinase activity was not contained in the chloroform-methanol extracts from hemocyte debris. The inhibition capacity of the components ceramide and phosphorylc…

Cell ExtractsHemocytesCiona intestinaliCytotoxicityHemocyteTunicate;Cell membraneHemolysin Proteinschemistry.chemical_compoundSphingomyelin inhibition;InvertebratePhospholipidsCiona intestinalis;biologyInvertebrate;PhosphatidylserineCiona intestinalisSphingomyelinsCytotoxicity;Sheep erythrocytesCholesterolSphingomyelin Phosphodiesterasemedicine.anatomical_structureBiochemistrylipids (amino acids peptides and proteins)SphingomyelinHemolysis inhibitionSphingomyelin inhibitionCeramideHemolysis inhibition;ImmunologyTunicateHemolysisMembrane LipidsPhosphatidylcholinemedicineAnimalsCiona intestinalisPhosphatidylethanolamineSheepPhosphorylcholineCell MembraneOsmolar ConcentrationCytotoxicity Tests Immunologicbiology.organism_classificationCulture MediaHemocytes;chemistryChromatography Thin LayerDevelopmental Biology
researchProduct

A Novel Peptide with Antifungal Activity from Red Swamp Crayfish Procambarus clarkii

2022

The defense system of freshwater crayfish Procambarus clarkii as a diversified source of bioactive molecules with antimicrobial properties was studied. Antimicrobial activity of two polypeptide-enriched extracts obtained from hemocytes and hemolymph of P. clarkii were assessed against Gram positive (Staphylococcus aureus, Enterococcus faecalis) and Gram negative (Pseudomonas aeruginosa, Escherichia coli) bacteria and toward the yeast Candida albicans. The two peptide fractions showed interesting MIC values (ranging from 11 to 700 μg/mL) against all tested pathogens. Polypeptide-enriched extracts were further investigated using a high-resolution mass spectrometry and database search and 14 n…

Microbiology (medical)Infectious Diseasescrustacean antimicrobial peptides; antibiotic resistant strains; high-resolution mass spectrometry; antibiofilm activity; <i>Candida albicans</i>Candida albicansantibiofilm activityPharmacology (medical)crustacean antimicrobial peptideshigh-resolution mass spectrometryGeneral Pharmacology Toxicology and PharmaceuticsBiochemistryMicrobiologyantibiotic resistant strains
researchProduct

Identification of Type I and IX Collagens in the Ascidian Ciona intestinalis

2001

Immunohistochemical methods showed that a type I collagen is a component of the tunic of Ciona intestinalis, involved in the encapsulation process. Since the fibril-forming collagen types are characterized by triple helical domain with a highly preserved Gly-Xaa-Yaa repeated sequence, a probe coding the fibril-forming type I collagen of the echinoderm Paracentrotus lividus was used to identify ascidian cDNA clones. Northern blot hybridization established that P. lividus probe cross-hybridizes with a 6 Kb C. intestinalis mRNA isolated from the pharynx. Using the echinodermal type I collagen cDNA as a probe several positive clones were identified. Analysis of sequence and the deduced amino ac…

chemistry.chemical_classificationbiologychemistryComplementary DNACiona intestinalisNorthern blotbiology.organism_classificationRepeated sequenceMolecular biologyHomology (biology)Paracentrotus lividusType I collagenAmino acid
researchProduct

Paracentrin 1, a synthetic antimicrobial peptide from the sea-urchin Paracentrotus lividus, interferes with staphylococcal and Pseudomonas aeruginosa…

2014

The rise of antibiotic-resistance as well as the reduction of investments by pharmaceutical companies in the development of new antibiotics have stimulated the investigation for alternative strategies to conventional antibiotics. Many antimicrobial peptides show a high specificity for prokaryotes and a low toxicity for eukaryotic cells and, due to their mode of action the development of resistance is considered unlikely. We recently characterized an antimicrobial peptide that was called Paracentrin 1 from the 5-kDa peptide fraction from the coelomocyte cytosol of the Paracentrotus lividus. In this study, the chemically synthesized Paracentrin 1, was tested for its antimicrobial and antibiof…

medicine.drug_classAMP (Antimicrobial peptides); Biofilm; Staphylococci; Pseudomonas aeruginosa; Paracentrotus lividusAntibioticsAntimicrobial peptidesBiophysicsSettore BIO/05 - ZoologiaPeptideBiologymedicine.disease_causeSettore BIO/19 - Microbiologia GeneraleApplied Microbiology and BiotechnologyParacentrotus lividusMicrobiologymedicineMode of actionAMP (Antimicrobial peptides)Staphylococcichemistry.chemical_classificationPseudomonas aeruginosaBiofilmBiofilmAntimicrobialbiology.organism_classificationchemistryParacentrotus lividusSettore CHIM/03 - Chimica Generale E InorganicaPseudomonas aeruginosaOriginal Article
researchProduct

Biological Responses of &lt;I&gt;Rhynchophorus ferrugineus&lt;/I&gt; (Coleoptera: Curculionidae) to &lt;I&gt;Steinernema carpocapsae&lt;/I&gt; (Nemat…

2013

Rhynchophorus ferrugineus (Olivier 1790) (Coleoptera: Curculionidae) is becoming a serious problem in Mediterranean areas where it is well-adapted, and now is present even in the United States (California). The infestations are primarily in urban areas where chemical control is not advisable and million of Euros are spent to control it. The effects of the entomopathogenic nematode Steinernema carpocapsae (Nematoda: Steinernematidae) on mortality, growth, as well as the immune activity of R. ferrugineus larvae, were investigated. R. ferrugineus mortality exhibited a positive trend with the dosage and duration of exposure to S. carpocapsae. The median lethal dose and median lethal time, impor…

LarvaVeterinary medicineEcologybiologyBiological pest controlXenorhabdusGeneral MedicineEntomopathogenic nematodebiology.organism_classificationMedian lethal doseToxicologyRhynchophorusMinimum inhibitory concentrationInsect ScienceCurculionidaeJournal of Economic Entomology
researchProduct

Effect of in vitro exposure to cadmiumand copper on sea bass blood cells

2009

Blood cells freshly collected from sea bass (Dicentrarchus labrax) were exposed in vitro to different concentrations of cadmium (Cd) and copper (Cu) at 10-7 M, 10-5 M, 10-3 M, and exam- ined for neutral red retention capacity and for cell vitality with MTT assay. A relationship between heavy metal exposure and alteration in responses of blood cells in a dose-time-dependent was found. Our results showed that fish blood cells may constitute an interesting biological model for experimen- tal and applied toxicology, especially in the case of environmental pollution.

Neutral redFish blood cells NR MTT040301 veterinary scienceschemistry.chemical_elementEnvironmental pollution0403 veterinary scienceToxicologychemistry.chemical_compoundMTT assaySea basslcsh:SF1-1100Cadmiumbiology0402 animal and dairy scienceAquatic animal04 agricultural and veterinary sciencesbiology.organism_classification040201 dairy & animal scienceMolecular biologyIn vitrochemistryFish blood cells Heavy metals NR MTTAnimal Science and ZoologyDicentrarchuslcsh:Animal culture
researchProduct

Cloning and expression of a type IX-like collagen in tissues of the ascidian Ciona intestinalis

2002

Collagens are highly preserved proteins in invertebrates and vertebrates. To identify the collagens in urochordates, the total RNA extracted from the pharynx of the ascidian Ciona intestinalis was hybridized with a heterologous probe specific for the echinoderm Paracentrotus lividus fibrillar type I-like larval collagen. Using this probe, two main bands (i.e. 6 and 2.8 kb mRNA) were observed on Northern blot hybridization. The cDNA library prepared from poly(A)+RNA extracted from pharyngeal tissue was screened and a cDNA that specifies a type IX-like collagen was identified. This molecule presents a conceptual open reading frame for a protein containing 734 amino acids. In particular, we sh…

Transcription GeneticAscidianMolecular Sequence DataBiophysicsIn situ hybridizationcDNA libraryBiochemistryCollagen Type IXMiceStructural BiologyComplementary DNAGeneticsAnimalsHumansCiona intestinalisTissue DistributionNorthern blotAmino Acid SequenceRNA MessengerCloning MolecularType IX-like collagenPeptide sequencePhylogenyGene LibraryMessenger RNAbiologyBase SequenceSequence Homology Amino AcidcDNA libraryRNAbiology.organism_classificationMolecular biologyCiona intestinalismRNA localizationSequence Alignment
researchProduct

Inflamed adult pharynx tissues and swimming larva of Ciona intestinalis share CiTNFalpha-producing cells.

2010

In situ hybridisation and immunohistochemistry analyses have shown that the Ciona intestinalis tumour necrosis factor alpha gene (CiTNFalpha), which has been previously cloned and sequenced, is expressed either during the inflammatory pharynx response to lipopolysaccharide (LPS) or during the swimming larval phase of development. Granulocytes with large granules and compartment/morula cells are CiTNFalpha-producing cells in both inflamed pharynx and larvae. Pharynx vessel endothelium also takes part in the inflammatory response. Haemocyte nodules in the vessel lumen or associated with the endothelium suggest the involvement of CiTNFalpha in recruiting lymphocyte-like cells and promoting the…

LipopolysaccharidesPathologymedicine.medical_specialtyHistologyHemocytesEndotheliumEvolutionMesenchymeSettore BIO/05 - ZoologiaInflammationIn situ hybridizationBiologyAscidia Ciona intestinalisPathology and Forensic MedicinemedicineAnimalsCiona intestinalisTumour necrosis factor; Pharynx; Inflammation; Haemocytes; Larval development; Innate immunity; Evolution; Ascidia Ciona intestinalisIn Situ Hybridization FluorescencePhylogenyInflammationInnate immunityInnate immune systemTumor Necrosis Factor-alphaPharynxMetamorphosis BiologicalHaemocytePharyngitisCell Biologybiology.organism_classificationImmunohistochemistryCiona intestinalismedicine.anatomical_structureLarval developmentLarvaImmunohistochemistryPharynxmedicine.symptomTumour necrosis factorGranulocytesCell and tissue research
researchProduct

Phenoloxidase characterization in vacuolar hemocytes from the solitary ascidian Styela plicata

1995

Phenoloxidase (PO) activity was shown in lysates of Styela plicata hemocytes assayed spectrophotometrically by means of L-Dopa oxidation without divalent cations. Trypsin and chymotrypsin pretreatment and preincubation with microbial lipopolysaccharides significantly activated PO, whereas laminarin or zymosan were ineffective. Soybean trypsin inhibitor, tropolone, and phenylthiourea, but not benzamidine, were inhibitors. Finally, hemocytes were separated by a discontinuous Percoll density gradient to determine which cells were active. PO activity was demonstrated, by both biochemical and cytochemical assays, in the separated fraction enriched mainly with the globular granulocytes called mor…

ChymotrypsinbiologyKunitz STI protease inhibitorL-DopaHemocytebiology.organism_classificationTrypsinMorula cellTunicateBenzamidineLaminarinchemistry.chemical_compoundStyela plicatachemistryBiochemistryHemolymphbiology.proteinmedicinePhenoloxidasePercollEcology Evolution Behavior and Systematicsmedicine.drug
researchProduct

Modulation of immune responses ofRhynchophorus ferrugineus(Insecta: Coleoptera) induced by the entomopathogenic nematodeSteinernema carpocapsae(Nemat…

2014

Aim of this study was to investigate relationships between the red palm weevil (RPW) Rhynchophorus ferrugineus (Olivier) and the entomopathogenic nematode Steinernema carpocapsae (EPN); particularly, the work was focused on the immune response of the insect host in naive larvae and after infection with the EPN. Two main immunological processes have been addressed: the activity and modulation of host prophenoloxidase-phenoloxidase (proPO) system, involved in melanization of not-self and hemocytes recognition processes responsible for not-self encapsulation. Moreover, immune depressive and immune evasive strategies of the parasite have been investigated. Our results suggest that RPW possess a…

biologymedia_common.quotation_subjectWeevilEntomopathogenic nematodeInsectbiology.organism_classificationGeneral Biochemistry Genetics and Molecular BiologyMicrobiologyRhynchophorusImmune systemInsect ScienceBotanyParasite hostingAgronomy and Crop ScienceRhabditidaEcology Evolution Behavior and SystematicsSymbiotic bacteriamedia_commonInsect Science
researchProduct

Marine biodiversity as source of new drugs

2013

Life in the oceans has an extraordinary biodiversity, including most of plant and animal taxa. Ecological pressures, including competition for space, the fouling of the surface, predation, and successful reproduction have led to the evolution of secondary metabolites and proteins with various biological activities (Cammarata et al. 2011; Maisano et al. 2013). Therefore, marine biodiversity is an exceptional reservoir of natural products, with different structural features from those of terrestrial natural products (Ireland et al. 1988). Only less than 1% of the natural products isolated from marine organisms have been examined for pharmacological activities (Fusetani 2000). These molecules …

AntifungalEcologymedicine.drug_classMicroorganismmedia_common.quotation_subjectBiodiversitySettore BIO/05 - ZoologiaBiodiversityBiologyCompetition (biology)PredationBiofoulingMarine biodiversityBenthic zonemedicineAnimal Science and Zoologymedia_common
researchProduct

Biological and Proteomic Characterization of the Anti-Cancer Potency of Aqueous Extracts from Cell-Free Coelomic Fluid of Arbacia lixula Sea Urchin i…

2022

Echinoderms are an acknowledged source of bioactive compounds exerting various beneficial effects on human health. Here, we examined the potential in vitro anti-hepatocarcinoma effects of aqueous extracts of the cell-free coelomic fluid obtained from the sea urchin Arbacia lixula using the HepG2 cell line as a model system. This was accomplished by employing a combination of colorimetric, microscopic and flow cytometric assays to determine cell viability, cell cycle distribution, the possible onset of apoptosis, the accumulation rate of acidic vesicular organelles, mitochondrial polarization, cell redox state and cell locomotory ability. The obtained data show that exposed HepG2 cells under…

reactive oxygen specieSettore CHIM/10 - Chimica Degli AlimentiSettore BIO/05 - ZoologiaHepG2 cellOcean Engineeringapoptosisea urchinechinodermmitochondrial transmembrane potentialcell cycleacidic vesicular organelleSettore BIO/06 - Anatomia Comparata E Citologiacoelomic fluidcoelomic fluid; sea urchin; echinoderm; HepG2 cells; apoptosis; cell cycle; acidic vesicular organelles; mitochondrial transmembrane potential; reactive oxygen species; wound healing assaywound healing assayWater Science and TechnologyCivil and Structural EngineeringJournal of Marine Science and Engineering
researchProduct

Histone Deacetylase Inhibitors from Marine Invertebrates

2020

Simple Summary Histone deacetylases (HDACs) are enzymes that control gene expression and are involved in the onset of serious human pathologies, including cancer; hence, their inhibitors (HDACis) have received increased attention in recent years. It is known that marine invertebrates produce significant amounts of molecules showing active pharmacological properties and an extensive spectrum of biomedical applications. This review is focused on the description of the molecular, biochemical, and, where available, physiological aspects of marine invertebrate-derived compounds that possess HDACi properties, taking into consideration their possible utilization as treatment agents against differe…

0301 basic medicineGene isoformbiomedical applicationsmarine invertebratesSettore BIO/05 - ZoologiaComputational biologyReviewhistone deacetylase inhibitorsGeneral Biochemistry Genetics and Molecular BiologyChromatin remodelinganticancer compound03 medical and health sciencesCnidaria0302 clinical medicineNon-histone proteinmarine invertebrateGene expressionEpigeneticsSettore BIO/06 - Anatomia Comparata E Citologiahistone deacetylase inhibitorlcsh:QH301-705.5General Immunology and MicrobiologybiologyMarine invertebratesanticancer compoundsPorifera030104 developmental biologyHistonelcsh:Biology (General)030220 oncology & carcinogenesisbiology.proteinbiomedical applicationHistone deacetylaseGeneral Agricultural and Biological SciencesEchinodermataBiology
researchProduct

Properties of sea urchin coelomocyte agglutinins

1996

We examined some biological activities of a 200-kDa glycoprotein, referred to as Paracentrotus lividus vitellogenin, contained both in the coelomic fluid and in a subpopulation of coelomocytes called «colourless spherula cells». Cell-free coelomic fluid, coelomocyte lysate and supernatant obtained after coelomocyte washings were assayed for hemagglutinating activity. All samples agglutinated rabbit erythrocytes in a calcium-dependent way. The comparison between the electrophoretic patterns of erythrocyte lysates, before and after incubation with the coelomic fluid, revealed that a 200-kDa band was obtained from membranes of agglutinated erythrocytes. In addition, polyclonal antibodies again…

chemistry.chemical_classificationcoelomocytebiologymedicine.diagnostic_testbiology.organism_classificationMolecular biologyParacentrotus lividussea urchinagglutininimmune systemVitellogeninAgglutininchemistryWestern blotPolyclonal antibodiesbiology.animalbiology.proteinmedicineadhesion moleculesAnimal Science and ZoologyGlycoproteinSea urchinCoelomocytegrainineItalian Journal of Zoology
researchProduct

Identification of New Antimicrobial Peptides from Mediterranean Medical Plant Charybdis pancration (Steinh.) Speta

2020

The present work was designed to identify and characterize novel antimicrobial peptides (AMPs) from Charybdis pancration (Steinh.) Speta, previously named Urginea maritima, is a Mediterranean plant, well-known for its biological properties in traditional medicine. Polypeptide-enriched extracts from different parts of the plant (roots, leaves and bulb), never studied before, were tested against two relevant pathogens, Staphylococcus aureus and Pseudomonas aeruginosa. With the aim of identifying novel natural AMPs, peptide fraction displaying antimicrobial activity (the bulb) that showed minimum inhibitory concentration (MICs) equal to 30 &micro

0301 basic medicineMicrobiology (medical)Charybdis030106 microbiologyAntimicrobial peptides) SpetaSettore BIO/05 - ZoologiatemporinPeptidemedicine.disease_causeSettore BIO/19 - Microbiologia GeneraleBiochemistryMicrobiologyMicrobiologyantibiotic resistant strains03 medical and health sciencesMinimum inhibitory concentrationAntibiotic resistancemedicinePharmacology (medical)high-resolution mass spectrometryGeneral Pharmacology Toxicology and Pharmaceuticsplant defensinschemistry.chemical_classificationbiologyPseudomonas aeruginosaantimicrobial peptides from plantCharybdis pancration (Steinh.) SpetaSettore BIO/02 - Botanica Sistematicalcsh:RM1-950temporinsbiology.organism_classificationAntimicrobialplant defensinmolecular dynamicslcsh:Therapeutics. Pharmacology030104 developmental biologyInfectious DiseaseschemistryStaphylococcus aureusCharybdis pancration (Steinhantimicrobial peptides from plants<i>Charybdis pancration</i> (Steinh.) Spetaantibiotic resistant strainAntibiotics
researchProduct

The European Pine Marten Martes martes (Linnaeus, 1758) Is Autochthonous in Sicily and Constitutes a Well-Characterised Major Phylogroup within the S…

2022

No molecular data are currently available for the Sicilian populations of the European pine marten Martes martes, thus preventing any sound inference about its native or non-native status on the island, as well as the local phylogeography of the species. In order to investigate these issues, we sequenced two mtDNA markers in road-killed specimens collected in Sicily. Both markers consistently demonstrated the existence of a well-characterised Sicilian clade of the species, which is endemic to the island and constitutes the sister group of a clade including the Mediterranean and Central–North European major phylogroups of the European pine marten. Such evidence supports the autochthony of Ma…

General Veterinarybiodiversity on islandsSettore BIO/05 - ZoologiaAnimal Science and Zoologymitochondrial DNAPleistocene refugiaQuaternary glaciationsPleistocene refugia; biodiversity on islands; mitochondrial DNA; Quaternary glaciationsAnimals; Volume 12; Issue 19; Pages: 2546
researchProduct

A synthetic derivative of antimicrobial peptide holothuroidin 2 from mediterranean sea cucumber (Holothuria tubulosa) in the control of Listeria mono…

2019

Due to the limited number of available antibiotics, antimicrobial peptides (AMPs) are considered antimicrobial candidates to fight difficult-to-treat infections such as those associated with biofilms. Marine environments are precious sources of AMPs, as shown by the recent discovery of antibiofilm properties of Holothuroidin 2 (H2), an AMP produced by the Mediterranean sea cucumber Holothuria tubulosa. In this study, we considered the properties of a new H2 derivative, named H2d, and we tested it against seven strains of the dangerous foodborne pathogen Listeria monocytogenes. This peptide was more active than H2 in inhibiting the growth of planktonic L. monocytogenes and was able to interf…

antimicrobial peptideAntibioticsSettore BIO/05 - ZoologiaPharmaceutical SciencePeptideSettore BIO/19 - Microbiologia Generalemedicine.disease_cause01 natural sciencesFoodborne DiseasesDrug DiscoveryListeriosislcsh:QH301-705.5Pharmacology Toxicology and Pharmaceutics (miscellaneous)chemistry.chemical_classification0303 health sciencesbiologyBiofilmFoodborne pathogenAntimicrobialHolothuria tubulosaAnti-Bacterial AgentsSettore CHIM/03 - Chimica Generale E InorganicaAntimicrobial peptidesmedicine.drug_classAntimicrobial peptides-Microbial Sensitivity TestsMolecular Dynamics SimulationArticleMicrobiology03 medical and health sciencesListeria monocytogenesDrug Resistance BacterialmedicineMediterranean SeaAnimalsHolothuria<i>Holothuria tubulosa</i>Listeria monocytogene030304 developmental biology010405 organic chemistryHolothuria tubulosaBiofilmbiology.organism_classificationSettore CHIM/08 - Chimica FarmaceuticaListeria monocytogenesProtein tertiary structure0104 chemical sciencesProtein Structure TertiaryFoodborne pathogenslcsh:Biology (General)chemistryBiofilmsDrug Design<i>Listeria monocytogenes</i>Antimicrobial Cationic Peptides
researchProduct

Univacuolar refractile hemocytes from the tunicate Ciona intestinalis are cytotoxic for mammalian erythrocytes in vitro

1996

A discontinuous, Percoll density gradient was used to separate hemocyte populations from the hemolymph of Ciona intestinalis. Hemocytes from each band were examined for their frequency, morphology, and cytotoxic activity against rabbit and sheep erythrocytes; results were expressed as a percentage of hemolysis. Statistical analysis revealed that only the "univacuolar" granulocytes from Band 5, which contain a vacuole of refractile material, were cytotoxic. Cytotoxic activity was inhibited by sphingomyelin. For the first time in tunicates, lytic activity against erythrocytes was assessed by an assay based on plaque-forming cells. Plaques of lysis were revealed against rabbit erythrocytes but…

HemocytesHemolytic Plaque TechniqueVacuoleCell SeparationHemolysisHemolytic Plaque TechniqueHemolysin ProteinsHemolymphHemolymphmedicineCentrifugation Density GradientCytotoxic T cellAnimalsCiona intestinalisSheepbiologybiology.organism_classificationmedicine.diseaseMolecular biologyHemolysisTunicateCiona intestinalisSphingomyelinsImmunologyRabbitsGeneral Agricultural and Biological SciencesPercoll
researchProduct

Does Bacillus thuringiensis Affect the Stress and Immune Responses of Rhynchophorus ferrugineus Larvae, Females, and Males in the Same Way?

2022

Simple Summary Rhynchophorus ferrugineus is a destructive quarantine pest of palm trees, now widely distributed. Although broad-spectrum insecticides are often used to protect palm against R. ferrugineus, there is increasing concern about their effects on the environment and human health, especially where palm trees are located in urban areas. As an environmentally friendly entomopathogen, Bacillus thuringiensis (Bt) has been widely used to prevent other pest infestations. Although Bt products are the most sold bio-insecticides, there are still many interesting features to be investigated in the relationship of Bt and its hosts. We investigated the effect of Bt on larvae, females, and males…

hemocytesSettore AGR/11 - Entomologia Generale E Applicatamedian lethal doseInsect SciencebrainfungiSettore BIO/05 - Zoologiastress responsemedian lethal timemedian lethal dose; median lethal time; stress response; hemocytes; brain; Hsp70Hsp70Insects; Volume 13; Issue 5; Pages: 437
researchProduct

Shipping noise affecting immune responses of European spiny lobster (Palinuruselephas)

2015

Marine crustaceans are influenced by numerous environmental factors. Environmental stress from pollutants seems to affect their metabolism, growth, moulting, survival, and immune defence. Recently, it has become clear that there is an impact of the global increase in sea noise levels due to shipping traffic on crustacean welfare. Considering the ecological and commercial importance of the European spiny lobster (Palinurus elephas (Fabricius, 1787)) in most parts of the Mediterranean coastal area, in the present study we investigated whether shipping noise pollution contribute to changing the immune parameters of stress in the European spiny lobster. The animals were exposed to a mix of nois…

Pollutantanimal structuresbiologyEcologyPalinurus elephafungiPalinurus elephasSettore BIO/05 - ZoologiaAquatic animalbiology.organism_classificationCrustaceanEuropean spiny lobsterImmune systemNoise pollutionPO activityAnimal Science and ZoologyHsp27Immune responseSpiny lobsterMoultingEcology Evolution Behavior and SystematicsShellfishCanadian Journal of Zoology
researchProduct

Stress and immune response to bacterial LPS in the sea urchin Paracentrotus lividus (Lamarck, 1816).

2018

The immune system of the sea urchin species Paracentrotus lividus is highly complex and, as yet, poorly understood. P. lividus coelomocytes mediate immune response through phagocytosis and encapsulation of non-self particles, in addition to the production of antimicrobial molecules. Despite this understanding, details of exactly how these processes occur and the mechanisms which drive them are still in need of clarification. In this study, we show how the bacterial lipopolysaccharides (LPS) is able to induce a stress response which increases the levels of the heat shock proteins HSP70 and HSP90 only a few hours after treatment. This study also shows that LPS treatment increases the expressi…

0301 basic medicineLipopolysaccharidesPhagocytosisAntimicrobial peptidesAquatic ScienceParacentrotus lividusAntimicrobical peptide03 medical and health sciencesImmune systemStress PhysiologicalHeat shock proteinbiology.animalEnvironmental ChemistryHSP90AnimalsSea urchinHSP70Heat-Shock ProteinsbiologyEchinoderm04 agricultural and veterinary sciencesGeneral Medicinebiology.organism_classificationHsp90Immunity InnateHsp70Cell biologyThymosin030104 developmental biologyImmune System040102 fisheriesbiology.proteinParacentrotus0401 agriculture forestry and fisheriesCoelomocyteParacentrotus lividuFishshellfish immunology
researchProduct

Gender differences in the immune system activities of sea urchin Paracentrotus lividus

2013

In the immune system of vertebrates, gender-specific differences in individual immune competence are well known. In general, females possess more powerful immune response than males. In invertebrates, the situation is much less clear. For this purpose we have chosen to study the immune response of the two sexes of the echinoderm Paracentrotus lividus in pre- and post-spawning phases. The coelomic fluid from the echinoderms contains several coelomocyte types and molecules involved in innate immune defenses. In this article we report that the degree of immune responses in the P. lividus differs according to sex in both pre- and post-spawning phases. We found in all tests that females were mor…

Cell ExtractsCytotoxicity ImmunologicMaleSex Determination AnalysisCoelomocyte innate immunityErythrocytesPhagocytePhysiologyCytotoxicitySettore BIO/05 - ZoologiaCell CountBiochemistryColoring AgentsSea urchinCoelomocyteCells CulturedPhagocytesSex CharacteristicsbiologyAnti-Bacterial Agentsmedicine.anatomical_structureEchinodermNeutral RedParacentrotusFemaleRabbitsNeutral red uptake.Staphylococcus aureusZoologyMicrobial Sensitivity TestsSaccharomyces cerevisiaeHemolysisParacentrotus lividusImmune systemPhagocytosisImmunitybiology.animalmedicineAnimalsGonadsMolecular BiologyCoelomocyte innate immunity; Ecological immunity; Gender; Cytotoxicity; Phagocytosis; Neutral red uptake.PhagocytosiInnate immune systemEcological immunityHemagglutinationGenderbiology.organism_classificationImmunity InnateImmunologyAntimicrobial Cationic PeptidesComparative Biochemistry and Physiology Part A: Molecular &amp; Integrative Physiology
researchProduct

Antimicrobial and Antibiofilm Activity of a Recombinant Fragment of β-Thymosin of Sea Urchin Paracentrotus lividus

2018

With the aim to obtain new antimicrobials against important pathogens such as Staphylococcus aureus and Pseudomonas aeruginosa, we focused on antimicrobial peptides (AMPs) from Echinoderms. An example of such peptides is Paracentrin 1 (SP1), a chemically synthesised peptide fragment of a sea urchin thymosin. In the present paper, we report on the biological activity of a Paracentrin 1 derivative obtained by recombination. The recombinant paracentrin RP1, in comparison to the synthetic SP1, is 22 amino acids longer and it was considerably more active against the planktonic forms of S. aureus ATCC 25923 and P. aeruginosa ATCC 15442 at concentrations of 50 &micro

0301 basic medicineSettore BIO/05 - ZoologiaPharmaceutical Science<i>Staphylococcus aureus</i>Peptide<i>Paracentrotus lividus</i>Settore BIO/19 - Microbiologia Generalemedicine.disease_causebiofilmDrug DiscoveryPharmacology Toxicology and Pharmaceutics (miscellaneous)lcsh:QH301-705.5chemistry.chemical_classificationbiologyMicrobial Sensitivity TestChemistrymolecular dynamicBiological activityRecombinant ProteinAntimicrobialRecombinant ProteinsAnti-Bacterial AgentsBiochemistrySettore CHIM/03 - Chimica Generale E InorganicaStaphylococcus aureusPeptidePseudomonas aeruginosaStaphylococcus aureuParacentrotusAntibacterial activityAMP (antimicrobial peptides)Staphylococcus aureusSea UrchinAntimicrobial peptidesMicrobial Sensitivity TestsParacentrotus lividusArticle03 medical and health sciencesAnti-Bacterial AgentmedicineAnimalsAMP (antimicrobial peptides); Paracentrotus lividus; Pseudomonas aeruginosa; Staphylococcus aureus; biofilm; molecular dynamics; thymosinAnimalBiofilmthymosinbiology.organism_classificationmolecular dynamics<i>Pseudomonas aeruginosa</i>030104 developmental biologylcsh:Biology (General)Paracentrotus lividusBiofilmsSea UrchinsParacentrotuPeptidesParacentrotus lividuMarine Drugs
researchProduct

Immune mediators of sea-cucumber Holothuria tubulosa (Echinodermata) as source of novel antimicrobial and anti-staphylococcal biofilm agents

2013

The present study aims to investigate coelomocytes, immune mediators cells in the echinoderm Holothuria tubulosa, as an unusual source of antimicrobial and antibiofilm agents. The activity of the 5kDa peptide fraction of the cytosol from H. tubulosa coelomocytes (5-HCC) was tested against a reference group of Gram-negative and Gram-positive human pathogens. Minimal inhibitory concentrations (MICs) ranging from 125 to 500 mg/ml were determined against tested strains. The observed biological activity of 5-HCC could be due to two novel peptides, identified by capillary RP-HPLC/nESI-MS/MS, which present the common chemical-physical characteristics of antimicrobial peptides. Such peptides were c…

Innate immunityInnate immune systembiologyPseudomonas aeruginosamedicine.drug_classBiofilm; Staphylococci; Antimicrobial peptides (AMP)BiofilmAntimicrobial peptidesHolothuria tubulosaAntibioticsBiophysicsBiofilmAntimicrobial peptides (AMP)Biological activitymedicine.disease_causeAntimicrobialbiology.organism_classificationSettore BIO/19 - Microbiologia GeneraleApplied Microbiology and BiotechnologyBiofilm Staphylococci Antimicrobial peptides (AMP) Innate immunityMicrobiologymedicineOriginal ArticleStaphylococci
researchProduct

ceRNA Network Regulation of TGF-β, WNT, FOXO, Hedgehog Pathways in the Pharynx of Ciona robusta

2021

The transforming growth factor-β (TGF-β) family of cytokines performs a multifunctional signaling, which is integrated and coordinated in a signaling network that involves other pathways, such as Wintless, Forkhead box-O (FOXO) and Hedgehog and regulates pivotal functions related to cell fate in all tissues. In the hematopoietic system, TGF-β signaling controls a wide spectrum of biological processes, from immune system homeostasis to the quiescence and self-renewal of hematopoietic stem cells (HSCs). Recently an important role in post-transcription regulation has been attributed to two type of ncRNAs: microRNAs and pseudogenes. Ciona robusta, due to its philogenetic position close to verte…

0301 basic medicineascidianpseudogenepseudogeneslcsh:ChemistryTransforming Growth Factor betaProtein Interaction MappingHomeostasisRNA-Seqlcsh:QH301-705.53' Untranslated RegionsSpectroscopyTissue homeostasisForkhead Box Protein O1Wnt signaling pathwayHigh-Throughput Nucleotide Sequencingvirus diseasesGeneral Medicinefemale genital diseases and pregnancy complicationsComputer Science ApplicationsCell biologyNGSStem cellTGF-βCell fate determinationBiologyCatalysisArticleInorganic ChemistryWNT03 medical and health sciencesmicroRNAAnimalsCell LineageHedgehog ProteinsTGF-Physical and Theoretical ChemistryMolecular BiologyHedgehogneoplasmsmiRNA030102 biochemistry & molecular biologyCompeting endogenous RNAOrganic ChemistryfungiComputational BiologyHematopoiesisWnt ProteinsMicroRNAs030104 developmental biologylcsh:Biology (General)lcsh:QD1-999Gene Expression RegulationImmune SystemPharynxFOXOCionaTransforming growth factorInternational Journal of Molecular Sciences
researchProduct

Identification of CPE and GAIT elements in 3’UTR of macrophage migration inhibitory factor (MIF) involved in inflammatory response induced by LPS in …

2018

Innate immune responses face infectious microorganisms by inducing inflammatory responses. Multiple genes within distinct functional categories are coordinately and temporally regulated by transcriptional 'on' and 'off' switches that account for the specificity of gene expression in response to external stimuli. Mechanisms that control transcriptional and post-transcriptional regulation are important in coordinating the initiation and resolution of inflammation. Macrophage migration inhibitory factor (MIF) is an important cytokine that, in Ciona robusta, is related to inflammatory response. It is well known that in C. robusta, formerly known as Ciona intestinalis, the pharynx is involved in…

Lipopolysaccharides0301 basic medicineUntranslated regionImmunology03 medical and health sciences0302 clinical medicineGene expressionAnimalsCiona intestinalisAmino Acid SequenceRNA Processing Post-Transcriptional3' Untranslated RegionsMacrophage Migration-Inhibitory FactorsMolecular BiologyGenePhylogenyInflammationRegulation of gene expressionInnate immune systemBase SequencebiologyThree prime untranslated regionbiology.organism_classificationImmunity InnateCiona intestinalisUp-RegulationAscidianMacrophage migration inhibitory factorInflammationLPSCiona robustaCell biology030104 developmental biologyGene Expression Regulation030220 oncology & carcinogenesisMacrophage migration inhibitory factorSequence AlignmentMolecular Immunology
researchProduct

Antibacterial activity of Mediterranean Oyster mushrooms, species of genus Pleurotus (higher Basidiomycetes).

2013

Extracts of the Mediterranean culinary-medicinal Oyster mushrooms Pleurotus eryngii var. eryngii, P. eryngii var. ferulae, P. eryngii var. elaeoselini, and P. nebrodensis were tested for their in vitro growth inhibitory activity against a group of bacterial reference strains of medical relevance: Staphylococcus aureus ATCC 25923, S. epidermidis RP62A, Pseudomonas aeruginosa ATCC 15442, and Escherichia coli ATCC10536. All of the Pleurotus species analyzed inhibited the tested microorganisms in varying degrees. The data included in this paper for P. nebrodensis and P. eryngii var. elaeoselinii are new reports.

OysterMicroorganismStaphylococcusHuman pathogenmedicine.disease_causePleurotusApplied Microbiology and BiotechnologySpecies Specificitybiology.animalDrug DiscoveryBotanymedicineEscherichia coliPleurotus eryngiiFood scienceEscherichia coliPharmacologyPleurotusBiological Productsbiologybiology.organism_classificationAnti-Bacterial AgentsStaphylococcus aureusSettore BIO/03 - Botanica Ambientale E ApplicataPseudomonas aeruginosamedicinal mushrooms antibacterial activity Pleurotus human pathogensAntibacterial activityAgaricalesInternational journal of medicinal mushrooms
researchProduct

FACIT collagen (1α-chain) is expressed by hemocytes and epidermis during the inflammatory response of the ascidian Ciona intestinalis

2007

Based on previous cloning and sequencing study, real-time PCR and in situ hybridization assays of the inflamed body wall of LPS-injected Ciona intestinalis showed the enhanced gene expression of a collagen with FACIT structural features (Ci-type IX-Col 1alpha-chain). By using specific antibodies raised against an opportunely chosen Ci-type IX-Col synthetic peptide, the fibroblast property of hemocytes challenged in vitro with LPS (at 4h) was displayed by flow cytometry, while immunocytochemistry identified hemocytes with large granules (morula cells) as collagen-producing cells. Hemocyte lysate supernatant analyzed in immunoblotting contained a 60 kDa band identifiable as 1alpha-chain-Ci-ty…

LipopolysaccharidesHemocytesImmunologyImmunocytochemistryIn situ hybridizationCollagen Type IXFACIT collagenExtracellular matrixParacrine CommunicationEscherichia colimedicineAnimalsCiona intestinalisFibroblastIn Situ HybridizationInflammationbiologyEpidermis (botany)Gene Expression Profilingbiology.organism_classificationImmunohistochemistryMolecular biologyCiona intestinalisExtracellular Matrixmedicine.anatomical_structureEpidermal CellsImmunologyEpidermisWound healingProtein Processing Post-TranslationalProcollagenDevelopmental BiologyDevelopmental &amp; Comparative Immunology
researchProduct

First Assessment of Plasticizers in Marine Coastal Litter-Feeder Fauna in the Mediterranean Sea

2021

Micro and nanoplastics are harmful to marine life due to their high level of fragmentation and resistance to degradation. Over the past two decades, marine coastal sediment has shown an increasing amount of microplastics being a sort of trap for debris wastes or chemicals. In such an environment some species may be successful candidates to be used as monitors of environmental and health hazards and can be considered a mirror of threats of natural habitats. Such species play a key role in the food web of littoral systems since they are litter-feeders, and are prey for fishes or higher trophic level species. A preliminary investigation was conducted on five species of small-sized amphipod cru…

0106 biological sciencesMicroplasticsmarine litterHealth Toxicology and MutagenesisFaunaMarine life010501 environmental scienceslcsh:Chemical technologyToxicologycoastal areas010603 evolutionary biology01 natural sciencesArticleplastic pollutionMediterranean seaMarine debrisMediterranean Sealcsh:TP1-11850105 earth and related environmental sciencesTrophic levelChemical Health and Safetyplastic pollution; marine litter; coastal areas; Crustacea Amphipoda; Mediterranean SeaEcologyFood webCrustacea AmphipodaEnvironmental sciencePlastic pollutionToxics
researchProduct

Detection of vitellogenin in a subpopulation of sea urchin coelomocytes.

1994

Sea urchin vitellogenin is a high molecular weight glycoprotein, which is the precursor of the major yolk protein present in the unfertilized egg. Vitellogenin processing into the major yolk protein and its further enzymatic cleavage during sea urchin embryonic development, has been extensively described, and the adhesive properties of the processed molecule have been studied. The function of vitellogenin in the adult, where it has been found in the coelomic fluid of both male and female individuals, is still unknown, although its role on promoting the adhesion of embryonic cells has been shown. In this report we describe the detection of vitellogenin in lysates of whole circulating coelomo…

MaleSea urchinVitellogeninCell BiologyBody FluidsVitellogeninsCoelomic fluidInvertebrate plasma proteinSea UrchinsAnimalsFemaleCoelomocyteStress MechanicalAnatomySubcellular Fractions
researchProduct

Population abundance, structure and movements of the European pond turtle, Emys orbicularis (Linnaeus 1758) based on capture-recapture data in a Veni…

2021

A freshwater turtle monitoring programme along the inland margins of the Venice lagoon was initiated in 2019 in collaboration with the World Wild Fund for Nature (WWF-Italy). From a total of 336 European pond turtles (Emys orbicularis) captured and marked, 97 freshwater turtles were recaptured at least once (28.9% return rate) providing important information on population size, structure and movements of mature individuals within the study area. The population size was estimated with capture-recapture method (Capture-Mark-Recapture-CMR) at 1009.4 ± 365.2 pond turtles, with a mean density of 252.3 ± 91.3 ind./ha. The analysis of the movements showed that the average distance covered intra-wa…

0106 biological sciencesEmys orbicularisSettore BIO/05 - ZoologiahabitatWetlanddensity; Emys orbicularis; habitat; lagoon; movements;Biology010603 evolutionary biology01 natural scienceslaw.inventionMark and recapturelaw0501 psychology and cognitive sciences050102 behavioral science & comparative psychologymovementsTurtle (robot)Ecology Evolution Behavior and Systematicsgeographydensitygeography.geographical_feature_categoryEmys orbicularisEcology05 social sciencesbiology.organism_classificationPopulation abundancelagoonHabitatAnimal Science and Zoology
researchProduct

Transcriptomic Analyses Reveal 2 and 4 Family Members of Cytochromes P450 (CYP) Involved in LPS Inflammatory Response in Pharynx of Ciona robusta

2021

Cytochromes P450 (CYP) are enzymes responsible for the biotransformation of most endogenous and exogenous agents. The expression of each CYP is influenced by a unique combination of mechanisms and factors including genetic polymorphisms, induction by xenobiotics, and regulation by cytokines and hormones. In recent years, Ciona robusta, one of the closest living relatives of vertebrates, has become a model in various fields of biology, in particular for studying inflammatory response. Using an in vivo LPS exposure strategy, next-generation sequencing (NGS) and qRT-PCR combined with bioinformatics and in silico analyses, compared whole pharynx transcripts from naïve and LPS-exposed C. robusta…

LipopolysaccharidesLPSCytochromeQH301-705.5cytochrome P450In silicoInflammationArticleGene Expression Regulation EnzymologicCatalysisInorganic ChemistryTranscriptomeCytochrome P-450 Enzyme SystemmicroRNAmedicineAnimalsBiology (General)Physical and Theoretical ChemistryQD1-999Ciona robusta<i>Ciona robusta</i>Molecular BiologyGenePhylogenySpectroscopymiRNAInflammationGeneticschemistry.chemical_classificationbiologyGene Expression ProfilingOrganic ChemistryHigh-Throughput Nucleotide SequencingCytochrome P450General MedicineCiona intestinalisComputer Science ApplicationsChemistryEnzymechemistryMultigene FamilyNGSbiology.proteinPharynxmedicine.symptomTranscriptomeInternational Journal of Molecular Sciences
researchProduct

Correction to: Echinodermata: The Complex Immune System in Echinoderms

2018

Immune systemImmunologyBiology
researchProduct

Haemolymphatic Parameters in Two Aquaculture Crustacean Species Cherax destructor (Clark, 1836) and Cherax quadricarinatus (Von Martens, 1868)

2022

In the last few years, there has been a notable development in the breeding of freshwater shrimp (astaciculture), which involved various species and in particular, the two Australian Parastacidae species, Cherax destructor and Cherax quadricarinatus. Information about the haemolymphatic parameters of these two species is fragmentary, and filling these gaps becomes important given their importance in aquaculture. Cellular and biochemical parameters were analyzed in both species to create a reference baseline for these parameters to identify the state of welfare or suffering of these animals. The results showed that the total haemocyte count, haemocyte subpopulations, enzymatic activities and…

total haemocytes countGeneral VeterinarycrayfishSettore BIO/10 - BiochimicaSettore BIO/05 - ZoologiaAnimal Science and Zoologytotal proteinaquaculture plantCherax spp.crayfish; <i>Cherax</i> spp.; total haemocytes count; total protein; aquaculture plantAnimals; Volume 12; Issue 5; Pages: 543
researchProduct

Cell cooperation in coelomocyte cytotoxic activity of Paracentrotus lividus coelomocytes

2007

The coelomic fluid from the sea urchin Paracentrotus lividus contains several coelomocyte types including amoebocytes and uncoloured spherulocytes involved in immune defences. In the present paper, we show a Ca(2+)-dependent cytotoxic activity for the unfractionated coelomocytes assayed in vitro, with rabbit erythrocytes and the K562 tumour cell line. In a plaque-forming assay, whole coelomocyte preparations as well as density gradient separated coelomocyte populations revealed that cell populations enriched in uncoloured spherulocytes, exerted high cytotoxic activity by releasing lysins in the presence of amoebocytes. This cooperative effect could be dependent on soluble factors released b…

Programmed cell deathErythrocytesPhysiologyCytotoxicityCell CommunicationCell SeparationBiochemistryParacentrotus lividusbiology.animalCentrifugation Density GradientAnimalsHumansCytotoxic T cellCytotoxicityMolecular BiologySea urchinCoelomocyteCoelomocyte cooperationInnate immunityCell DeathEchinodermbiologyAnatomybiology.organism_classificationIn vitroCell biologyParacentrotus lividusCell cultureParacentrotusRabbitsCoelomocyteK562 CellsComparative Biochemistry and Physiology Part A: Molecular &amp; Integrative Physiology
researchProduct

Echinodermata: The complex immune system in echinoderms

2018

View references (418) The Echinodermata are an ancient phylum of benthic marine invertebrates with a dispersal-stage planktonic larva. These animals have innate immune systems characterized initially by clearance of foreign particles, including microbes, from the body cavity of both larvae and adults, and allograft tissue rejection in adults. Immune responsiveness is mediated by a variety of adult coelomocytes and larval mesenchyme cells. Echinoderm diseases from a range of pathogens can lead to mass die-offs and impact aquaculture, but some individuals can recover. Genome sequences of several echinoderms have identified genes with immune function, including expanded families of Toll-like r…

0301 basic medicineImmunoglobulin geneProteomicsSea CucumbersAntimicrobial peptidesDiseasesImmune responsesBiologySenescenceImmune development03 medical and health sciences0302 clinical medicineImmune systemAsteroideaAsteroidea Brittle stars Coelomocytes Crinoidea Diseases Echinoidea Genomics Holothuroidea Immune development Immune responses Immuno-toxicology Larval immune cells Ophiuroidea Proteomics Sea cucumbers Sea lilies Sea stars Sea urchins SenescenceApostichopus JaponicusSea cucumbersAsteroidea; Brittle stars; Coelomocytes; Crinoidea; Diseases; Echinoidea; Genomics; Holothuroidea; Immune development; Immune responses; Immuno-toxicology; Larval immune cells; Ophiuroidea; Proteomics; Sea cucumbers; Sea lilies; Sea stars; Sea urchins; SenescenceCrinoideaSea starsHolothuroideaOphiuroideaSea urchinsInnate immune systemCoelomocytesfungiLarval immune cellsSea liliesChemotaxisEchinoideaMarine invertebratesGenomicsbiology.organism_classificationComplement systemCell biology030104 developmental biologyEchinodermBrittle starsCoelomocytes Apostichopus Japonicus Sea CucumbersImmuno-toxicology030217 neurology & neurosurgery
researchProduct

Green Extraction of Polyphenols from Waste Bentonite to Produce Functional Antioxidant Excipients for Cosmetic and Pharmaceutical Purposes: A Waste-t…

2022

In an ever-growing perspective of circular economy, the development of conscious, sustainable and environmental-friendly strategies to recycle the waste products is the key point. The scope of this work was to validate the waste bentonite from the grape processing industries as a precious matrix to extract polyphenols by applying a waste-to-market approach aimed at producing novel functional excipients. The waste bentonite was recovered after the fining process and opportunely pre-treated. Subsequently, both the freeze dried and the so-called &ldquo;wet&rdquo; bentonites were subjected to maceration. PEG200 and Propylene Glycol were selected as solvents due to their ability to dissolve poly…

PEG200PhysiologybentoniteClinical BiochemistryCell Biologywaste productBiochemistrycosmeceutical excipientsbentonite; waste product; extraction; polyphenols; grape processing industry; propylene glycol; PEG200; cosmeceutical excipients; pharmaceutical excipients; waste-to-market approachSettore CHIM/09 - Farmaceutico Tecnologico Applicativopropylene glycolwaste-to-market approachextractionpharmaceutical excipientsMolecular Biologygrape processing industrypolyphenolsAntioxidants
researchProduct

Underwater noise from boats: Measurement of its influence on the behaviour and biochemistry of the common prawn (Palaemon serratus, Pennant 1777)

2016

Abstract This study examined the effects of recorded boat noises on the behaviour and biochemistry of the common prawn ( Palaemon serratus ) in laboratory settings. The experiment was carried out in a tank equipped with a video-recording system using six groups (three control and three tested) of eight common prawns (48 animals in total). After habituation for 1 h, the behaviour of the prawns was monitored for 1 h. During the last 30 min, the animals in the test groups were exposed to noise resembling a marine area with high anthropogenic acoustic pollution. The exposure to noise produced significant changes in locomotor patterns, presence inside or outside a shelter, total protein concentr…

0106 biological sciencesNoise pollution010604 marine biology & hydrobiologyCommon prawnAquatic ScienceBiologybiology.organism_classificationEcology Evolution Behavior and Systematic010603 evolutionary biology01 natural sciencesPalaemon serratusCrustaceanFisheryNoiseBiochemistryBiochemical streAquatic sciencePrawnBehaviourBoat noiseHabituationEcology Evolution Behavior and SystematicsInvertebrateJournal of Experimental Marine Biology and Ecology
researchProduct

A peptide from human β thymosin as a platform for the development of new anti-biofilm agents for Staphylococcus spp. and Pseudomonas aeruginosa

2016

Conventional antibiotics might fail in the treatment of biofilm-associated infections causing infection recurrence and chronicity. The search for antimicrobial peptides has been performed with the aim to discover novel anti-infective agents active on pathogens in both planktonic and biofilm associated forms. The fragment 9-19 of human thymosin β4 was studied through 1 μs MD simulation. Two main conformations of the peptide were detected, both constituted by a central hydrophobic core and by the presence of peripheral charged residues suggesting a possible mechanism of interaction with two models of biological membranes, related to eukaryotic or bacterial membrane respectively. In addition, …

Models Molecular0301 basic medicineStaphylococcus aureusPhysiology030106 microbiologyAntimicrobial peptidesSettore BIO/05 - ZoologiaPeptideMicrobial Sensitivity TestsMolecular Dynamics SimulationBiologymedicine.disease_causeSettore BIO/19 - Microbiologia GeneraleApplied Microbiology and BiotechnologyMicrobiologyStructure-Activity Relationship03 medical and health sciencesAnti-Infective AgentsmedicineHumansAmino Acid SequencePeptide sequencechemistry.chemical_classificationPseudomonas aeruginosaAntimicrobial peptides Molecular dynamics Staphylococcal biofilms ThymosinBiofilmThymosinGeneral MedicineAntimicrobialSettore CHIM/08 - Chimica FarmaceuticaThymosin030104 developmental biologychemistryBiochemistrySettore CHIM/03 - Chimica Generale E InorganicaBiofilmsPseudomonas aeruginosaPeptidesAntibacterial activityBiotechnology
researchProduct

Tributyltin affects phagocytic activity of Ciona intestinalis hemocytes

1995

Organotin compounds have been used in marine anti-fouling paints as biocides. Because tunicates are vulnerable to these compounds in their natural habitats, we used Ciona intestinalis to establish an assay for phagocytosis in vitro of yeast by hemocytes after exposure to different concentrations (0.0015, 0.015, 0.15 and 1.5 microM) of four organotin compounds: tributyltin (TBT), triphenyltin (TPT), dibutyltin (DBT) and diphenyltin (DPT). To evaluate the phagocytic activity, we used a method based on fluorescence excitation of yeast pre-treated with eosin-Y. The percentage of phagocytosis decreased from 45.1 +/- 3.49 to 22.4 +/- 5.14 at 1.5 microM of TBT (P0.001); it was significantly reduce…

BiocideDiphenyltin;HemocytesAscidianStrePhagocytosisImmunologyIonophoreHemocyteAscidian;Dibutyltin;Toxicologychemistry.chemical_compoundPhagocytosis;Tributyltin;DiphenyltinPhagocytosisAnimalsCiona intestinalisCalcimycinPharmacologyPhagocytesStress;PhagocytosibiologyTributyltinbiology.organism_classificationYeastIn vitroCiona intestinalisTripheniltinHemocytes;BiochemistrychemistryTributyltinDibutyltinTrialkyltin CompoundsXenobiotic
researchProduct

Changes in the proteome of sea urchin Paracentrotus lividus coelomocytes in response to LPS injection into the body cavity.

2020

Background The immune system of echinoderm sea urchins is characterised by a high degree of complexity that is not completely understood. The Mediterranean sea urchin Paracentrotus lividus coelomocytes mediate immune responses through phagocytosis, encapsulation of non-self particles, and production of diffusible factors including antimicrobial molecules. Details of these processes, and molecular pathways driving these mechanisms, are still to be fully elucidated. Principal findings In the present study we treated the sea urchin P. lividus with the bacterial lipopolysaccharide (LPS) and collected coelomocytes at different time-points (1, 3, 6 and 24 hours). We have shown, using label-free q…

ProteomicsLipopolysaccharidesProteomeHydrolasesBiochemistry0302 clinical medicineParacentrotusMedicine and Health SciencesSea urchinCoelomocyteImmune ResponseCytoskeleton0303 health sciencesPhagocytesMultidisciplinarybiologyChemistryQREukaryotaAnimal ModelsCell biologyEnzymesEchinodermExperimental Organism Systems030220 oncology & carcinogenesisProteomeParacentrotusMedicineProtein Interaction NetworksCellular Structures and OrganellesNetwork AnalysisResearch ArticleEchinodermsComputer and Information Sciencesfood.ingredientScienceImmunologyLipopolysaccharideEndocytosisResearch and Analysis MethodsParacentrotus lividusLymphatic System03 medical and health sciencesfoodPhagocytosisbiology.animalHeat shock proteinDNA-binding proteinsAnimalsProtein Interactions030304 developmental biologyPhagocytosiAnimalOrganismsBiology and Life SciencesProteinsCell Biologybiology.organism_classificationInvertebratesCytoskeletal ProteinsGuanosine TriphosphataseProtein-Protein InteractionsPhagocyteImmune SystemSea UrchinsAnimal StudiesEnzymologyParacentrotuPLoS ONE
researchProduct

Inflammatory hemocytes in Ciona intestinalis innate immune response

2009

In the present paper an attempt is carried out to revise Ciona intestinalis inflammatory hemocytes according to their morphology as formerly observed by light and electron microscopy, and taking in account recent reports on innate immunity gene expression. We also examine hemocyte morphofunctional aspects as derived from previous papers that refer to the tunic and body wall inflammatory responses challenged by corpusculate or soluble agents. LPS inoculation into the body wall or treating hemocytes in vitro with LPS have also been taken in account. LPS inoculation stimulated the expression of CiTNF alpha, CiFACIT- alpha chain collagen, CiC3a, CiCD94 and enhanced phenoloxidase activity. These…

hemocytelcsh:Biology (General)inflammationtunicateinnate immunity inflammation hemocyte Ciona intestinalisinnate immunitylcsh:QH301-705.5Ciona intestinalis
researchProduct

Transcriptomic and Bioinformatic Analyses Identifying a Central Mif-Cop9-Nf-kB Signaling Network in Innate Immunity Response of Ciona robusta

2023

The Ascidian C. robusta is a powerful model for studying innate immunity. LPS induction activates inflammatory-like reactions in the pharynx and the expression of several innate immune genes in granulocyte hemocytes such as cytokines, for instance, macrophage migration inhibitory factors (CrMifs). This leads to intracellular signaling involving the Nf-kB signaling cascade that triggers downstream pro-inflammatory gene expression. In mammals, the COP9 (Constitutive photomorphogenesis 9) signalosome (CSN) complex also results in the activation of the NF-kB pathway. It is a highly conserved complex in vertebrates, mainly engaged in proteasome degradation which is essential for maintaining proc…

LPSOrganic ChemistrySettore BIO/05 - ZoologiaGeneral MedicineSettore BIO/08 - AntropologiaCatalysisComputer Science ApplicationsInorganic ChemistrycytokineSettore BIO/06 - Anatomia Comparata E CitologiaPhysical and Theoretical Chemistry<i>Ciona robusta</i>Ciona robustatranscriptomeinnate immunityMolecular BiologySpectroscopymiRNAInternational Journal of Molecular Sciences
researchProduct

Evolutionary conserved pathway of the innate immune response after a viral insult in Paracentrotus lividus sea urchin

2019

Despite the apparent simplicity of the body organization of echinoderms, their immune system is competent to perform a complex innate immune response, which is far from being well understood. The echinoderms represent the most advanced invertebrates that form a bridge with the primitive chordates. In fact, they possess numerous receptors and effectors that are used to obtain a fast immune response. After an infection, the humoral and cellular immune response determines a network in which the main protagonists are membrane and endosomal receptors. The recognition of nonself molecules by specific membrane receptors triggers the immune response, stimulating consecutive intracellular events. We…

0301 basic medicinemedicine.medical_treatmentImmunologySettore BIO/05 - ZoologiaParacentrotus lividusEvolution Molecular03 medical and health sciences0302 clinical medicineImmune systemDownregulation and upregulationbiology.animalGeneticsmedicineAnimalsReceptorMolecular BiologySea urchinGenetics (clinical)Innate immune systembiologyEffectorGeneral Medicinebiology.organism_classificationBiological EvolutionImmunity InnateCell biology030104 developmental biologyCytokineVirus DiseasesParacentrotusevolution innate immunity invertebrate animals model organism030215 immunology
researchProduct

Antimicrobial activity of the red palm weevil Rhynchophorus ferrugineus

2011

The red palm weevil, Rhynchophorus ferrugineus (Olivier) (Coleoptera Dryophthoridae), is an important pest of palms. Knowl- edge of both its natural enemies and its defensive mechanisms against predators and microorganisms is important to develop methods for an integrated pest control. Antimicrobial activity of the cuticular surface of adults and larvae, as well as of eggs, of this invasive species was investigated. This activity was tested against the Gram-positive bacteria Bacillus subtilis (Ehrenberg) Cohn and Bacillus thuringiensis Berliner, the Gram-negative bacterium Escherichia coli Escherich, and the entomopathogenic fungi Beauveria bassiana (Balsamo) Vuillemin and Metarhizium aniso…

Rhynchophorus ferrugineus palm pest biological control antimicrobial activity polar substances.
researchProduct

A member of the Tlr family is involved in dsRNA innate immune response in Paracentrotus lividus sea urchin

2015

Abstract The innate immune response involves proteins such as the membrane receptors of the Toll-like family (TLRs), which trigger different intracellular signalling pathways that are dependent on specific stimulating molecules. In sea urchins, TLR proteins are encoded by members of a large multigenic family composed of 60–250 genes in different species. Here, we report a newly identified mRNA sequence encoding a TLR protein (referred to as Pl-Tlr) isolated from Paracentrotus lividus immune cells. The partial protein sequence contained the conserved Toll/IL-1 receptor (TIR) domain, the transmembrane domain and part of the leucine repeats. Phylogenetic analysis of the Pl-Tlr protein was acco…

LipopolysaccharidesEvolutionImmunologySettore BIO/05 - ZoologiaMediterranean sea urchinParacentrotus lividusImmune systemToll-like receptorPhylogeneticsbiology.animalAnimalsRNA MessengerGeneSea urchinPhylogenyRNA Double-StrandedImmune cellToll-like receptorInnate immune systembiologyEcologyToll-Like ReceptorsReceptors Interleukin-1biology.organism_classificationBiological EvolutionImmunity InnateProtein Structure TertiaryUp-RegulationCell biologyTransmembrane domainPoly I-CSea UrchinsGene expressionDevelopmental BiologyDevelopmental &amp; Comparative Immunology
researchProduct

Inducible lectins with galectin properties and human IL1alpha epitopes opsonize yeast during the inflammatory response of the ascidian Ciona intestin…

2007

Studies on inducible ascidian lectins may shed light on the evolutionary emergence of cytokine functions. Here, we show that the levels of opsonins, with IL1alpha-epitopes, increase in Ciona intestinalis hemolymph as a response to an inflammatory stimulus and, in particular, to intratunic injection of lipopolysaccharide (LPS). The inflammatory agent promptly (within 4 h) enhances Ca(2+)-independent serum hemagglutinating and opsonizing activities, which are both inhibited by D-galactose and D-galactosides (alpha-lactose, N-acetyl-D-lactosamine, thio-digalactoside), suggesting that anti-rabbit erythrocyte lectins with galectin properties are involved as opsonins. Inducible galectin molecules…

LipopolysaccharidesHistologyLipopolysaccharideGalectinsSaccharomyces cerevisiaeCross ReactionsEpitopeEvolution . Inflammatory response . Phagocytosis . Opsonins . Lectins . IL1α-like galectins . Ascidian Ciona intestinalis (Tunicata)AntibodiesPathology and Forensic Medicinelaw.inventionchemistry.chemical_compoundEpitopesWestern blotPhagocytosisOpsonin ProteinslawHemolymphInterleukin-1alphaLectinsmedicineAnimalsHumansCiona intestinalisGalectinbiologymedicine.diagnostic_testGalactoseGalactosidesCell BiologyBlood ProteinsOpsonin Proteinsbiology.organism_classificationMolecular biologyBlood proteinsRecombinant ProteinsCiona intestinalisHemagglutininsBiochemistrychemistryRecombinant DNACalciumRabbitsCell and tissue research
researchProduct

RISPOSTA IMMUNITARIA DEL PUNTERUOLO ROSSO NEI CONFRONTI DEL ENTOMOPATOGENO BACILLUS THURINGIENSIS

2009

Introdotto accidentalmente in Sicilia nel 2005 Rhynchophorous ferrugineus Olivier (Coleoptera Curculionidae), noto come punteruolo rosso, ha infestato velocemente e gravemente molte palme. La sua espansione è veloce e i potenziali stress abiotici e biotici presenti nel nuovo areale non sembrano costituire dei possibili agenti di contenimento. Si è cercato di comprendere il perché di tale resistenza trattando larve di punteruolo con uno dei maggiori batteri entomopageni attualmente conosciuti il Bacillus thuringiensis Berliner (Bt). Gli studi eff ettuati hanno evidenziato una certa mortalità ma soprattutto un’interazione con l’attività trofi ca. Per comprendere meglio questi eff etti si è st…

Rhynchophorous ferrugineus lotta biologica Bt sistema immunitario emociti
researchProduct

FACIT collagen (1alpha-chain) is expressed by hemocytes and epidermis during the inflammatory response of the ascidian Ciona intestinalis

2008

Based on previous cloning and sequencing study, real-time PCR and in situ hybridization assays of the inflamed body wall of LPS-injected Ciona intestinalis showed the enhanced gene expression of a collagen with FACIT structural features (Ci-type IX-Col 1a-chain). By using specific antibodies raised against an opportunely chosen Ci-type IX-Col synthetic peptide, the fibroblast property of hemocytes challenged in vitro with LPS (at 4 h) was displayed by flow cytometry, while immunocytochemistry identified hemocytes with large granules (morula cells) as collagen-producing cells. Hemocyte lysate supernatant analyzed in immunoblotting contained a 60 kDa band identifiable as 1a-chain-Ci-type IX-C…

Type IX collagenHemocytesCiona intestinaliInflammatory responseCiona intestinalis; Inflammatory response; Type IX collagen; Hemocytes
researchProduct

Bacillus thuringiensis treatment modulate the HSP70 expression in larva and adult brain of Rhynchophorus ferrugineus

2013

To study the pathogen-host relationship, we used the model of the entomopathogenic bacterium Bacillus thuringiensis (Bt) and Rhynchophorus ferrugineus, a quarantine pest that attacks palm trees. In particular, we focused on the Bt stress-induced infections. We studied the effect of Bt on larval and adult growth, and on the expression of the heat shock proteins (HSPs), rapidly synthesized in the cell after exposure to stress including pathogens. Bt has negative effects on larval and adult growth, on total hemocytes counts and on the hemocyte type. HSP70 was evaluated in the supernatant of the brain lysate obtained from larvae and adults fed with sublethal doses of Bt. HSP70 expression was mo…

Red Palm Weevil pests diseases stress answer Bacillus thuringiensis HSP70Settore BIO/05 - Zoologia
researchProduct

Preliminary evidence for the cytotoxic molecule in hemocyte supernatant lysate from Ciona intestinalis unilocular hemocytes

2006

researchProduct

Antibacterial activity of Pleurotus species

2013

Basidiomycetes express promising antitumor, immune modulating, cardiovascular and hypercholesterolemia, antiviral, antibacterial and antiparasitic effects (Wasser & Weis, 1999; Reshetnikov et al., 2001; Wasser, 2002, Didukh et al., 2003). They are also well known for their safety and efficacy as functional foods and dietary supplements (Wasser & Akavia, 2008). The antibacterial and antiviral value of different genera of Basidiomycetes has been tested by different authors (Benedict & Brady, 1972; Donnelly et al., 1986; Gao et al., 2003;). In particular the antibacterial and antiparasitic therapeutic effects were investigated in the genera Flammulina P. Karst, Fomes (Fr.) Fr., Ganoderma P. Ka…

Antibacterial activity Pleurotus medicinal mushrooms
researchProduct

Galectine nella risposta infiammatoria di Ciona intestinalis cDNA ed espressione genica

2009

Galectine risposta infiammatoriaCiona intestinalis
researchProduct

Modulazione In vivo dell’Hsp70 negli emociti di Rhynchophorus ferrugineus dopo trattamento con Bacillus thuringiensis

2011

Diversi tipi di stress ambientali possono indurre l’espressione delle Hsps vengono rapidamente sintetizzate all'interno delle cellule dopo esposizione ad uno stressor. Le HSPs sono raggruppate in diverse famiglie in base alle dimensioni delle proteine. Nella maggior parte degli organismi ci sono diversi geni che codificano i membri di questa famiglia HSP. In studi precedenti è stata valutata l'interazione tra Bacillus thuringiensis e gli emociti circolanti di Rhynchophorus ferrugineus il punteruolo rosso delle palme. Questo coleottero è grande, da due a cinque centimetri di lunghezza, ed è di colore rosso ruggine, le sue larve scavano buche fino a un metro lungo il tronco delle palme, e può…

HSP70 Rhynchophorus ferrugineusSettore BIO/05 - Zoologia
researchProduct

Le simbiosi in ambiente marino

2011

L’adattamento e la conseguente selezione naturale ha prodotto un’infinita varietà di organismi viventi, ciascuno dotato di peculiari caratteristiche, per consentire ad ogni specie di utilizzare l’ambiente in cui vive. I membri che formano le comunità naturali creano tra di essi dei complessi sistemi fatti di rapporti di competizione e di cooperazione. Questi, contribuiscono ad assicurare l’evoluzione delle specie nell’efficace opera di utilizzazione dell’ambiente. Nell’ambito delle relazioni tra individui di specie diverse esistono alcune singolari associazioni che si evolvono insieme, stabilendo un legame intimo e duraturo che comporta un elevato grado di specializzazione da parte dei cont…

Settore AGR/11 - Entomologia Generale E ApplicataSettore BIO/05 - Zoologiasimbiosi barriera corallina rapporti trofici insetti marini
researchProduct

Biological responses of Rhynchophorus ferrugineus (Coleoptera: Curculionidae) to Steinernema carpocapsae (Nematoda: Steinernematidae).

2013

Rhynchophorus ferrugineus (Olivier 1790) (Coleoptera: Curculionidae) is becoming a serious problem in Mediterranean areas where it is well-adapted, and now is present even in the United States (California). The infestations are primarily in urban areas where chemical control is not advisable and million of Euros are spent to control it. The effects of the entomopathogenic nematode Steinernema carpocapsae (Nematoda: Steinernematidae) on mortality, growth, as well as the immune activity of R. ferrugineus larvae, were investigated. R. ferrugineus mortality exhibited a positive trend with the dosage and duration of exposure to S. carpocapsae. The median lethal dose and median lethal time, impor…

AgingImmunity CellularHemocytesNematodaSettore BIO/05 - ZoologiaMicrobial Sensitivity TestsSettore BIO/19 - Microbiologia GeneraleXenorhabdusImmunity HumoralMedian lethal dose median lethal time minimum inhibitory concentration total hemocyte count biological controlSettore AGR/11 - Entomologia Generale E ApplicataLarvaAnimalsWeevilsPest Control BiologicalJournal of economic entomology
researchProduct

Exploring the impact of the invasive algae Caulerpa taxifolia var. distichophylla and C. cylindracea on the performance of the sea urchin Paracentrot…

2014

Settore BIO/07 - Ecologiaalien species global warmind sea urchin
researchProduct

FRAGMENTS OF BETA-THYMOSIN FROM THE SEA-URCHIN PARACENTROTUS LIVIDUS AS NOVEL ANTIMICROBIAL PEPTIDES AGAINST STAPHYLOCOCCAL BIOFILMS

2012

With the aim to face the threat of pathogen biofilms intrinsically resistant to conventional antibiotics, we focused on coelomocytes, the immune mediators in echinoderms, as source of novel antimicrobial peptides (AMPs). The proteic fraction <5kDa from coelomocytes cytosol of the sea-urchin Paracentrotus lividus (5-CC) was tested against a group of Gram positive and Gram negative pathogen reference strains. The 5-CC of P. lividus resulted active against all tested strains at concentrations ranging from 15.8 to 253.7 mg/mL. The ability to prevent staphylococcal biofilm formation was evaluated against the biofilm of clinical strain S.epidermidis 1457 using live/dead staining in combination wi…

Antibiotic resistanceBiofilmAntimicrobial peptidesSettore BIO/19 - Microbiologia GeneraleStaphylococci
researchProduct

Paracentrin1, a synthetic antimicrobial peptide fragment of a beta-thymosin from the sea-urchin Paracentrotus lividus, interferes whith staphylococca…

2014

Settore BIO/05 - ZoologiaPeptidi antimicrobici biofilms Pseudomonas aeruginosa Staphylococcus aureus Paracentrotus lividusSettore BIO/19 - Microbiologia GeneraleSettore CHIM/08 - Chimica Farmaceutica
researchProduct

Anti biofilm activity of Paracentrotus lividus coelomocytes

2010

Paracentrotus lividusSettore BIO/05 - Zoologia
researchProduct

Attività antibatterica di peptidi estratti da celomociti di echinodermi

2010

Negli echinodermi la difesa dell’organismo dalle invasioni microbiche avviene tramite meccanismi cellulari e umorali dell’immunità innata. Una componente fondamentale dei fattori umorali è costituita dai peptidi antimicrobici (AMPs) molto conservati con un ampio spettro di attività antimicrobica contro batteri, virus e funghi. Solitamente gli AMPs sono costituiti da meno di 100 amminoacidi, sono cationici e formano strutture anfipatiche. In questo lavoro dimostriamo che i celomociti dell’Echinoideo Paracentrotus lividus e dell’Oloturoideo Holothuria tubulosa contengono sostanze con attività antimicrobica verso diversi ceppi batterici patogeni umani. In entrambe le specie, nel precipitato ac…

Immunità naturaleanti biofilmSettore BIO/05 - Zoologiapeptidi antibattericiechinoderniSettore BIO/19 - Microbiologia Generale
researchProduct

Components of hemocyte extracts from marine invertebrates exert antimicrobial activity

2013

antimicrobial activityHemocyte antimicrobial activity
researchProduct

Cellule che producono ciTNFalfa sono attive nell'infiammazione e nello sviluppo larvale di Ciona intestinalis

2010

Settore BIO/05 - ZoologiaCiona intestinalis
researchProduct

A D-galactose specific lectin is an inducible inflammatory IL-1-like opsonin in the hemolymph of the ascidian Ciona intestinalis challegend with LPS.

2006

researchProduct

Attivazione del sistema della profenolossidasi nella risposta infiammatoria della tunica di Ciona intestinalis (L.)

2007

researchProduct

Preliminary results on the interaction between Bacillus thuringensis and Red Palm Weevil.

2008

Bacillus thuringensis Red Palm Weevil.
researchProduct

Espressione dell'attività acetilcolinesterasica nelle cellule lateralidel tronco della larva e negli emociti di Ascidie solitarie

2007

researchProduct

Novel antimicrobial and anti-biofilm agents from a marine invertebrate

2011

Biofim antimicrobial marine invertebratesSettore BIO/19 - Microbiologia Generale
researchProduct

EFFECT OF Bacillus thuringiensis ON RESPIRATION RATES OF MARINE INTERTIDAL MYTILASTER INTERTIDAL, MYTILASTER MINIMUS (MOLLUSCA, BIVALVIA)

2010

Increasing body of research deals with the impact of agricultural products marine environment. Indeed it is expected to detect insecticides, including the ones for biocontrol, in nearshore marine waters and thus predicting where, when and with what magnitude these impacts are most likely to occur is imperative if we are effectively interested in understanding the role of biological products as Bacillus thuringiensis (Bt) on marine biodiversity. Bivalves are important elements of marine biodiversity and very often they play a role of ecosystem engineers in that many other species structurally depend on their presence. Oxygen consumption through respiration in these organisms varies with natu…

Settore BIO/07 - EcologiaSettore AGR/11 - Entomologia Generale E ApplicataBt non target effects biopesticidesSettore BIO/05 - Zoologia
researchProduct

Natural immunity in Paracentrotus lividus: coelomocyte cooperation

2005

researchProduct

Purification and characterization of D-galactose binding lectin involved in the inflammatory response in Ciona intestinalis

2006

researchProduct

Further insight on Ciona intestinalis prophenoloxidase system activated during the LPS induced inflammatory response

2010

Ciona intestinalis
researchProduct

Effetti del cadmio sull'espressione delle HSP70 nelle cellule del sangue di Spigola (Dicentrachus labrax L. Osteichthyes, Moronidae)

2008

cadmiumDicentrachus labraxHSp70
researchProduct

Antioxidant response, induced by the invasive algae Caulerpa distichophylla and C. racemosa, in the sea urchin Paracentrotus lividus

2014

Settore BIO/07 - EcologiaAlien algae caulerpenin heat shock proteins
researchProduct

Antimicrobial activity of the extracts of Terfezia claveryi and Tirmania pinoyi against gram-positive and gram-negative bacteria causal agent of dise…

2017

Tomato diseases caused by virus, bacteria and fungi have been reported worldwide and caused considerable economic losses. Among all diseases, attention is paid to those caused by bacteria. In this study, the extracts of two “desert truffles” Terfezia claveryi and Tirmania pinoyi were tested against six bacterial species, causal agent of economically important tomato diseases: Pseudomonas corrugata, P. mediterranea, P. syringae pv. tomato Pectobacterium carotovorum subsp. carotovorum, Xanthomonas vesicatoria and Clavibacter michiganensis subsp. michiganansis. The extracts from both fungal species, evaluated by agar well diffusion method, showed an antimicrobial activity against all the teste…

lcsh:Computer engineering. Computer hardwareSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetalelcsh:TP155-156lcsh:TK7885-7895Chemical Engineering (all)lcsh:Chemical engineeringDesert truffles Antimicrobial activity tomato diseases
researchProduct

First evidences of Toll like receptor on Paracentrotus livisua coelomocytes.

2004

researchProduct

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

In vivo modulation of Hsp70 in Rhynchophorus ferrugineus hemocytes after Bacillus thuringiensis treatment

2010

Heat shock proteins (Hsps) are rapidly synthesized within stressed cells after exposure to an environmental stressor. A variety of environmental stresses, including heat, cold, trace-metal exposure, xenobiotics have been reported to modulate Hsps expression in various organisms. Hsps are grouped into several families based on their protein size. Most organisms have several genes encoding members of this Hsp family. In particularly Hsp70 can be induced quickly under stressful conditions, but return to a normal expression level under non-stressful conditions. Few studies have been done to detect the Hsp70 expression in phytophagous insects towards pathogens. Since a preliminary research discl…

Settore AGR/11 - Entomologia Generale E ApplicataSettore BIO/05 - ZoologiaRed Palm weevil HSP 70 Stress entomopathogenic bacteria Bt screening
researchProduct

Morphological characterization and acetylcholinesterase activity in Ciona intestinalis hemocytes

2008

Ciona intestinalis hemocytes
researchProduct

Novel marine invertebrate-derived antimicrobial peptides against staphylococcal biofilm

2009

microbial biofilmsSettore BIO/19 - Microbiologia GeneraleAntimicrobial peptide Staphylococcus aureu
researchProduct

Comparison among the responses of the greater wax moth, Galleria mellonella and red palm weevil Rhynchophorus ferrugineus to the entomopathogenic nem…

2013

The entomopathogenic nematode-bacterium complex of Steinernema-Xenorhabdus has high potential as lethal biological control agent against many insect pest species. The Red Palm Weevil (RPW) Rhynchophorus ferrugineus (Coleoptera: Curculionidae) is an important worldwide palm trees pest. This insect is a quarantined pest, accidentally introduced in Sicily in 2005. The pest is killed by Steirnenema carpocapsae, but nematodes are unable to reproduce in the RPW larvae. This research try to understand the reasons of the inability of S. carpocapsae to complete its life cycle in the host comparing what happens in one of the most suitable host, the greater wax moth, Galleria mellonella (Lepidoptera: …

life cycle Galleria mellonella Rhynchophorus ferrugineus Steinernema carpocapsae
researchProduct

Invertebrate lectins present cytokine properties.

2007

researchProduct

Inflamed adult pharynx tissues and swimming larva of Ciona intestinalis share CiTNFalfa-producing cells

2010

Settore BIO/05 - ZoologiaCiona intestinalis
researchProduct

Invertebrate lectins present cytockine properties.

2007

researchProduct

Attività citotossica dei celomociti di Holothuria tubulosa (Echinodermata)

2010

Numerosi studi hanno accertato che nel fluido celomatico degli echinodermi sono presenti cellule con attività diretta verso agenti estranei. In particolare i celomociti svolgono un repertorio di funzioni immunitarie tra cui la fagocitosi, la citotossicità, l’attività antibatterica, la formazione di capsule e il rigetto dei trapianti. Nel presente lavoro abbiamo studiato l’attività citotossica dei celomociti di Holothuria tubulosa (Oloturoideo) non separati ed abbiamo utilizzato cellule di mammifero come target. I celomociti prelevati dal fluido celomatico lisano gli eritrociti di coniglio o di montone e le cellule tumorali della linea eritromieloide umana K562. Inoltre anche il supernatante…

immunità naturalecitotossicitàInvertebratiSettore BIO/05 - ZoologiaHolothuriaechinodermi
researchProduct

Nuovi dati sulla risposta infiammatoria dell’ascidia Ciona intestinalis

2004

researchProduct

Paracentrin 1, a synthetic antimicrobial peptide fragment of a beta-thymosin from the sea-urchin Paracentrotus lividus, interferes with staphylococca…

2014

biofilm pathogens antimicrobial peptidesSettore BIO/19 - Microbiologia GeneraleSettore CHIM/08 - Chimica Farmaceutica
researchProduct

A response of Rhynchophorous ferrugineus (Coleoptera: Curculionidae) larval hemocytes to Bacillus thuringiensis

2010

Bacillus thuringiensisRhynchophorous ferrugineu
researchProduct

Effetti modulanti del poliacrilato sulla tossicità del TMT-CI in immunociti di Paracentrotus lividus.

2007

researchProduct

Anesthetic efficacy of ketamine-diazepam, ketamine-xylazine, and ketamine-acepromazine in Caspian Pond turtles (Mauremys caspica)

2017

Objectives: The objective of this study was to assess the efficacy of different anesthetic drug combinations on the Caspian Pond turtles (Mauremys caspica). Subjects and Methods: Three groups of the Caspian Pond turtles (n = 6) were anesthetized with three different drug combinations. Initially, a pilot study was conducted to determine the best drug doses for the anesthetization of the turtles, and according to these results, ketamine-diazepam (120 mg/kg ketamine hydrochloride [5%] and 2 mg/kg diazepam [5%]), ketamine-acepromazine (120 mg/kg ketamine hydrochloride [5%] and 1 mg/kg acepromazine [1%]), and ketamine-xylazine (120 mg/kg ketamine hydrochloride [5%] and 1 mg/kg xylazine [2%]) wer…

MaleXylazinePharmacologyDiazepamketamineDose-Response Relationship DrugTime FactorAnimalAnestheticSex FactorInjections IntramuscularTurtleAnesthesia Recovery PeriodFemalePilot ProjectPharmacology (medical)Mauremys caspicaAcepromazine
researchProduct

Tunicate immunocytes can be cytotoxic toward foreign cells

2008

Settore BIO/05 - ZoologiaTunicate cytotoxic toward
researchProduct

Sphingomyelin as well as carbohydrates are involved in the mechanism of cytotoxic molecules contained and released in vitro by Ciona intestinalis gra…

2008

researchProduct

Espressione della proteina di resistenza multixenobiotica (MXR) in Mytilus galloprovincialis in aree tirreniche meridionali

2007

researchProduct

Effect of exposure cadmium on the echinoderm Paracentrotus lividus (Echinoidea)

2008

cadmiumParacentrotus lividusSettore BIO/05 - Zoologiaphagocytosi
researchProduct

Sistema immunitario del Punteruolo rosso

2009

sistema immunitarioSettore BIO/05 - Zoologiapunteruolo rossorhynchophorous ferrugineus
researchProduct

Parametri sierologici e cellulari della specie alloctona Procambarus clarckii

2011

Procambarus clarkii è un animale d’acqua dolce originario del Centro-Sud degli Stati Uniti e del Nord-Est del Messico. Questa specie rientra nella lista delle 100 specie invasive più pericolose al mondo (Delivering Alien Invasive Species Inventories for Europe) in quanto presenta una serie di caratteristiche biologiche, che la rendono una minaccia per la biodiversità. In Sicilia la sua presenza è stata registrata per la prima volta nel 2003 nella riserva naturale “Lago Preola e Gorghi Tondi”, Mazara del Vallo (TP). Allo scopo di conoscere meglio la biologia di questa specie, su esemplari di P. clarkii provenienti dalla riserva di Trapani, abbiamo esaminato i tipi emocitari ed alcune attivit…

specie alloctona HSP70Settore BIO/05 - Zoologia
researchProduct

Modulation of prophenoloxidase activity in Ciona intestinalis inflammatory response

2006

researchProduct

Effetti di Bacillus thuringiensis nella sua forma vegetativa sulle larve di Rhynchophorous ferrugineus (Coleoptera Curculionidae)

2010

Il batterio Bacillus thuringiensis (Bt) è un patogeno di molti insetti ed è ampiamente impiegato, sottoforma di spore, nella lotta biologica. La forma vegetative (Btv) è considerata quella responsabile della setticemia dell’ospite dopo che le tossine (Cry) rilasciate dal corpo parasporale del Bt in forma sporulata (Bts) hanno perforato il mesenteron del ospite. Tuttavia poco è conosciuto relativamente ai meccanismi di difesa dell’insetto nelle fasi successive alla azione delle tossine Cry. Lo scopo del presente lavoro è quello di studiare gli effetti del Btv sulle larve del fitofago Rhynchophorous ferrugineus Olivier (Coleoptera: Curculionidae) a seguito di iniezioni sub letali di Btv. Ques…

Settore AGR/11 - Entomologia Generale E ApplicataPunteruolo rosso palme emociti Bt entomopatogeni tossine ad azione insetticidaSettore BIO/05 - Zoologia
researchProduct

The immune mediators in echinoderms as souce of novel AMPs against microbial biofilms

2012

Marine invertebrate coelomocytes innate immunity staphylococcal biofilmsSettore BIO/19 - Microbiologia Generale
researchProduct

NEW ANTIMICROBIAL AND ANTI-BIOFILM AGENTS FROM THE SEA URCHIN PARACENTROTUS LIVIDUS

2005

researchProduct

Echinoderm Antimicrobial Peptides: The Ancient Arms of the Deuterostome Innate Immune System

2016

Antimicrobial peptides (AMPs) are widely expressed in organisms and have been linked to innate and acquired immunity in vertebrates. These compounds are constitutively expressed from different cellular types to interact directly with infectious agents and/or modulate immunoreactions. In invertebrates, including echinoderms, which lack a vertebrate-type adaptive immune system, AMPs represent the major humoral defense system against infection, showing a diverse spectrum of action mechanisms, most of them related to plasma membrane disturbance and lethal alteration of microbial integrity. Here, we summarize the knowledge of AMPs in echinoderms as Strongylocins identified in the sea urchins, St…

Antibiofilm peptideInnate immunityEchinodermImmunology and Microbiology (all)BiofilmMedicine (all)Settore BIO/05 - ZoologiaAntimicrobial peptideSettore BIO/19 - Microbiologia Generale
researchProduct

ANTIMICROBIAL PEPTIDES FROM COELOMOCYTES CYTOSOL OF PARACENTROTUS LIVIDUS WITH PHARMACEUTICAL POTENTIAL AS ANTI-STAPHYLOCOCCI BIOFILM AGENTS

2007

Aims: To evaluate the anti-biofilm activity of the commercially available essential oils from two Boswellia species. Methods and Results: The susceptibility of staphylococcal and Candida albicans biofilms was determined by methyltiazotetrazolium (MTT) staining. At concentrations ranging from 217Æ3 lg ml)1 (25% v ⁄ v) to 6Æ8 lg ml)1 (0Æ75% v ⁄ v), the essential oil of Boswellia papyrifera showed considerable activity against both Staphylococcus epidermidis DSM 3269 and Staphylococcus aureus ATCC 29213 biofilms. The anti-microbial efficacy of this oil against S. epidermidis RP62A biofilms was also tested using live ⁄ dead staining in combination with fluorescence microscopy, and we observed t…

researchProduct

The cytotoxic activity of Ciona intestinalis (ascidian) unilocular refractile hemocytes versus K562 tumor cells and mammalian erythrocytes involves p…

2010

HemocytesCiona intestinaliSettore BIO/05 - ZoologiaPhospholypase
researchProduct

An alternative set of test to bioassay for bioinsecticides

2010

The development of an assay to determine insecticidal properties for either biological and conventional plant protection products plays an important role on the early screening of potential pathogens or derived toxins candidates. The standard methods for the evaluation it has been by bioassay, especially determination of LD50 or LC 50 requiring the use of relatively large numbers of insects and toxin tests. There are several problems connected with these bioassays: availability of insects and in the right life stage, mass producing the candidate species, preparation, reproducibly and costs relative to intensive manpower. These aspects are really important especially when bio-insectides shou…

Settore AGR/11 - Entomologia Generale E ApplicataBacillus thuringiensis Rhynchophorous ferrugineus screening entomopathogens HSP 70 growth inhibition.Settore BIO/05 - Zoologia
researchProduct

Preliminary results on antimicrobial activity of Rhynchophorous ferrugineus hemolymph

2011

Rhynchophorus ferrugineus (Coleoptera: Curculionidae), known as the Red Palm Weevil (RPW) and accidentally introduced in the Mediterranean areas, is considered a quarantine pest for tree palms especially in the urban environment. In order to understand the relationship among potential pathogens and RPW several studies were carried out on RPW immune system. Here we report the results of a preliminary study undertaken to investigate the effect of naturally occurring antimicrobial activities present both in the cell free hemolymph and in hemocytes lysate supernatant of RPW. The hemolymph was extracted from the older larvae sampled from infested palm trees. The protein fractions were extracted …

Settore AGR/11 - Entomologia Generale E ApplicataSettore BIO/05 - ZoologiaSettore BIO/14 - FarmacologiaRed Palm Weevil hemolynph minimal inhibitory concentrations (MICs) antibiotic.
researchProduct

AMPs and biotechnology application for new generation of medical devices

2013

AMPsbiotechnology application medical devices
researchProduct

HEAT SHOCK POTEINS (HSP) IN BRACHIDONTES PHARAONIS (MOLLUSCA, BIVALVIA) AT VARYING TEMPERATURES

2008

Settore BIO/07 - EcologiaHeat shock proteinBrachidontes pharaonis temperature effect MediterraneanSettore BIO/05 - Zoologia
researchProduct

La fascia costiera: Caratteristiche e Criticità per la gestione e lo sviluppo ecosostenibile del territorio e della pesca. Consorzio di Ripopolamento…

2008

Ripopolamento itticoFascia Marina Costiera
researchProduct

Molecular characterization of biofilm-forming S.aureus field isolates and their treatment

2008

PIA S.aureusSettore BIO/19 - Microbiologia Generale
researchProduct

Expression of a type IX-like collagen in tissue injury of the ascidian Ciona intestinalis durino inflammatory process

2006

researchProduct

Effetti modulanti del cadmio e del rame sulle attività cellulari del teleosteo Dicentrarchus labrax

2007

researchProduct

Il sistema della profenolossidasi nella risposta infiammatoria della tunica di Ciona intestinalis (L.)

2007

researchProduct

Effetti del cadmio sulle attività cellulari dell’echinoderma Paracentrotus lividus (Echinoidea)

2008

cadmium phagocytosis
researchProduct

Bacillus thuringiensis treatment alters larval growth, hemocytes and modulation of Hsp70 in Rhynchophorus ferrugineus

2011

To study the pathogen-host relationship, we used the model of the entomopathogenic bacterium Bacillus thuringiensis (Bt) and Rhynchophorus ferrugineus, a quarantine pest that attacks the palm trees. In particular, we focused on the Bt stress-induced infections. We studied the effect of Bt on larval growth, on hemocytes and on the expression of the heat shock proteins (Hsp70). HSPs are rapidly synthesized in the cells after a stress exposition including pathogens. The Hsp70 was evaluated in the supernatant of the hemocyte lysate (HLS) obtained from larvae fed with Bt. This is the first time that the presence of Hsp70 has been recorded in R. ferrugineus. Bt has negative effects on larval grow…

Settore AGR/11 - Entomologia Generale E ApplicataSettore BIO/05 - ZoologiaRed Palm Weevil pests diseases stress response Bacillus thuringiensis Hsp70
researchProduct

Effect of Bacillus thuringiensis on physiological rates of Mediterranean marine intertidal Mytilaster minimus (Mollusca, Bivalvia)

2010

The aim of the present research is to evaluate the impact of agricultural products in the marine environments. Indeed in a country such as Italy and in particularly Sicily where agricultural areas nearshore marine waters, predicting where, when and with what magnitude the impact of xenobiotics derived from agriculture is imperative. In this contest we use as model a biological product (Bacillus thuringiensis) in understanding its potential effects on non target species and on marine biodiversity. Bivalves are important elements of marine biodiversity and very often they play a role of ecosystem engineers in that many other species structurally depend on their presence. Moreover as they cons…

Bacillus thuringiensis Mytilaster minimus Intertidal biopollutionSettore BIO/05 - Zoologia
researchProduct

In vitro effects of methylmercury on ascidian (Styela plicata) immunocyte responses

2007

This study shows that high methylmercury concentrations are cytotoxic for Styela plicata hemocytes, whereas sublethal concentrations affect immunocyte responses. Moreover, hemocytes exposed to the xenobiotic present a significantly enhanced phenoloxidase activity as revealed in the hemocyte lysate supernatant compared with the control. Although the cytotoxic activity of S. plicata hemocytes toward rabbit erythrocytes is a PO-dependent cell-target reaction due to quinone products, it was significantly decreased by suitable methylmercury concentrations in the medium. The same xenobiotic concentrations decreased the hemocyte phagocytic activity toward yeast. In both the responses cell-target c…

Ascidian Galectin Endostyle Inflammation Ciona intestinalisbiologyChemistryPhagocytosisGeneral ChemistryImmunotoxicologybiology.organism_classificationMolecular biologyIn vitroTunicateInorganic ChemistryToxicologychemistry.chemical_compoundStyela plicataCytotoxic T cellXenobioticMethylmercury
researchProduct

In vivo modulation of Bacillus thuringiensis (commercial form) on Holothuria tubulosa immune defense mechanisms

2010

In invertebrates, cellular and humoral components are evolved to maintain their homeostais and integrity. Both these components respond to different non-self such as microorganisms, vertebrate erythrocytes and foreign proteins. The aim of this research was to study the possible modulating effects of Bacillus thuringiensis (Bt) in a commercial and vegetative form on the immune response of the echinoderm, sea cucumber Holothuria tubulosa. Bt is one of the most used biopesticides worldwide, covering the 90% of the organic market. Sicily is a region vocated to biological control and agricultural area are often closed to the coastal area. Investigate the effect of biopesticides on other non targ…

Settore BIO/05 - ZoologiaInvertebrate biopollution Holothuria tubulosa Bacillus thuringiensis innate immune defense
researchProduct

An Attempt to re-examine the immune role of Ciona intestinalis hemocytes

2009

Ciona intestinalis hemocytes
researchProduct

Evoluzione dell’immunità innata. Componenti della reazione infiammatoria indotta da LPS nella parete corporea dell’ascidia Ciona intestinalis.

2005

researchProduct

I pesci "taggati"

2010

Settore BIO/05 - ZoologiaparassitiPesci
researchProduct

Effect of Bacillus thuringiensis as vegetative form on hemocytes of Rhynchophorous ferrugineus (Coleoptera Curculionidae) larvae

2010

The bacterium Bacillus thuringiensis (Bt) is a pathogen of many insect species and is actively used in biocontrol. The vegetative form as been reported to be involved in insect septicemia process. Bt during the vegetative stage of growth, is known to secern a new family of insecticidal proteins. Moreover recently evidence has been provided, that B. thuringiensis can establish itself in replicative and vegetative form on the leaf surface. Little is known on the interaction of pathogens with the defense responses of phytophagous insects. Insect circulating hemocytes are primarily responsible for the immune defense against parasites and pathogens. We use as model Rhynchophorous ferrugineus Oli…

Settore AGR/11 - Entomologia Generale E ApplicataSettore BIO/05 - ZoologiaRed Palm weevil Hemocytes Immune system Plasmatocytes Biological control
researchProduct

Antimicrobial Activity of the Desert Truffles "Tirmania pinoyi" and "Terfezia claveryi" Against Human Pathogens

2015

The development of novel antimicrobials in the struggle against pathogens and antibiotic resistance is one of the most important global challenges of our time. Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial and immune stimulating properties1. In recent years the traditional studies on epigeous higher Basidiomycetes have been joined by those on hypogeous fungi and in particular on the so-named “desert truffles”. Ali2 demonstrated that organic extraction of truffles of genus Tirmania and Terfezia possess antimicrobial activity with broad-spectrum effects against Gram positive, Gram negative, aerobic and anaerobic bacteria …

Settore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore BIO/19 - Microbiologia GeneraleDesert Truffles Antimicrobial activity Human pathogens
researchProduct

Espressione di galactine nell'infiammazione e nella larva natante di Ciona intestinalis

2010

Ciona iontestinaliGalactineSettore BIO/05 - Zoologia
researchProduct

Enhanced CiTNFα expression is an inflammatory response of the ascidian Ciona intestinalis

2009

CiTNFα inflammatory response Ciona intestinalis
researchProduct

Il sistema della profenolossidasi in Ciona intestinalis durante il processo infiammatorio indotto da LPS

2010

ProfenolossidasiCiona intesinalisSettore BIO/05 - Zoologia
researchProduct

The Ciona intestinalis prophenoloxidase activating system during LPS inflammatory reaction

2009

Ciona intestinalis LPS
researchProduct

Amendment of the type locality of the endemic Sicilian pond turtle Emys trinacris Fritz et al. 2005, with some notes on the highest altitude reached …

2016

The type locality of the Sicilian pond turtle Emys trinacris is here amended, and its correct name and geographical coordinates are provided. The locus typicus of the species lies at 1007 m a.s.l., i.e. nearly 400 m below what previously thought. The updated altitudinal distribution range of the species, based on verified published localities only, is between 0 and 1036 m a.s.l.

0106 biological sciences0301 basic medicineSettore BIO/05 - Zoologia030108 mycology & parasitologyEmydidae010603 evolutionary biology01 natural sciences03 medical and health sciencesType localitylcsh:ZoologyAltitudinal limit type locality Sicily Emydidaelcsh:QL1-991SicilyAltitudinal limitActa Herpetologica
researchProduct

Nuovi dati sull'attivazione della profenolossidasi di Ciona intestinalis nel processo infiammatorio

2009

immunitàprofenolossidasiciona intestinaliprocesso infiammatorio.
researchProduct

Antimicrobial and anti-staphylococcal biofilm peptides from the sea-urchin Paracentrotus lividus

2006

researchProduct

Il cirripede Pollicipes pollicipes una prelibatezza galiziana

2010

CirripediPollicipes pollicipes
researchProduct

Prophenoloxidase system is activated in the tunic inflammatory response of ciona intestinalis

2007

researchProduct

Inflammation in ascidians

2004

researchProduct

Modulazione di heat shock protein (HSP) in Brachidontes pharaonis (Mollusca, Bivalvia) in condizioni di temperatura variabile

2008

Brachidontes
researchProduct

Molecules and cells in inflammatory responses of the ascidian Ciona intestinalis

2006

researchProduct

Influenza della sostanza organica policarbossilica sulla tossicità di triorganostagno in ambienti marini. Effetti modulanti del poliacrilato sulla to…

2007

researchProduct

EFFECTOR CELLS FROM PARACENTROTUS LIVIDUS AS SOURCE OF NEW ANTI-STAPHYLOCOCCI BIOFILM AGENTS

2007

researchProduct

La risposta infiammatoria in Ciona intestinalis è caratterizzata dall’aumento di lectine specifiche per D-galattosidi e dall’espressione di collagene…

2007

researchProduct

Analisi del comparto pesca

2006

researchProduct

Effetti del cadmio sulla fagocitosi e sull'attività di formazione di placche di lisi dei celomociti di Parcentrotus lividus

2007

researchProduct

Adaptations to thermal variation in two Mediterranean limpets - cardiac response and haemocyte lysosomal stability

2012

Patella rustica and Patella caerulea are two congeneric limpet species, both occurring along the rocky shores of the Mediterranean but on different tidal heights. P. rustica is dominant in the upper intertidal zone while P. caerulea is more abundant in the lower part of the same zone. Understanding variations in physiological adaptations to thermal stress is vital when investigating intertidal species' distribution. Hence, to investigate the relationship between their physiological thermal tolerance and intertidal zonation, laboratory experiments were designed to test the hypothesis that the lower zoned P. caerulea has reduced upper thermal limits when compared with higher zoned P. rustica,…

limpets thermal stress Arrhenius temperature lysosomal stabilitySettore BIO/05 - Zoologialimpets; thermal stress; Arrhenius temperature; lysosomal stability
researchProduct

Preliminare caratterizzazione di un’attività citotossica nel supernatante del lisato degli emociti con granulo rifrangente di Ciona intestinalis

2007

researchProduct

Evolution of Innate Immunity. Components of inflammatory reaction in Ciona intestinalis

2005

researchProduct

Biological responses of Rhynchophorous ferrugineus to Steirnenema carpocapase: an example of a model system

2011

Rhynchophorus ferrugineus (Coleoptera: Curculionidae) known as the Red Palm Weevil (RPW) is becoming more and more of a problem in Italy, and especially in Sicily, where it is well adapted. The infestations are mainly in the urban areas, and for that reason, chemical control is not advisable. Data from literature show that entomopathogenic nematodes (EPN) control RPW quite successfully in the field. However, results coming from the laboratories are often in contrast with each other and no data are available on precise doses. In this context we studied the Median Lethal Dose (DL50) and the Median Lethal Time (TL50) of young and older larvae and also of adults. The doses for the adults were t…

entomopathogenic nematodes larval growth hemocytes Median Lethal Time Lethal Dose
researchProduct

Meccanismi dell’immunità naturale in echinodermi. Interazioni tra i celomociti di Paracentrotus lividus

2004

researchProduct

Espression of a type IX-like collagen in tissue injury of the ascidian Ciona intestinalis during inflammatory process

2006

researchProduct

INDAGINI SULLA RISPOSTA IMMUNITARIA DEL PUNTERUOLO ROSSO NEI CONFRONTI DEI NEMATODI ENTOMOPAGENI

2009

Il Punteruolo rosso delle palme (Rhynchophorus ferrugineus Olivier, 1790. Coleoptera Curculionidae), originario dell’Asia meridionale si è velocemente diff uso nell’areale mediterraneo attaccando diversi generi di palme e creando seri problemi al settore ornamentale e vivaistico, oltre che alle aree verdi delle città. Il controllo di questo fi tofago si è rivelato problematico e di diffi cile realizzazione a causa delle sue proprietà invasive. Allo stato attuale non sono stati individuati patogeni effi caci nella lotta biologica, anche se i nematodi entomopatogeni (EPN) sono stati impiegati con discreto successo in Spagna. Generalmente gli EPN sono impiegati contro gli stadi larvali ma poic…

Rhynchophorus ferrugineus EPN Steirnenema carpocapsae Lotta biologica Phoenix canariensis palme
researchProduct

Dal Campo al Museo, le scienze naturali attraverso la didattica ambientale

2010

Settore BIO/05 - ZoologiaScienze naturaliDidattica ambientale
researchProduct

Enhanced expression of a CinTNF gene in the LPS challenged inflammatiry responses of the ascidian Ciona intestinalis

2008

researchProduct

Interazioni tra il sistema immunitario del Punteruolo rosso e il batterio entomopatogeno Bacillus thuringensis

2009

Punteruolo rossosistema immunitarioSettore BIO/05 - ZoologiaBacillus thuringensi
researchProduct

Effects of cadmium on expression of the hsp70 in sea bass (Dicentrarchus labrax L., Osteichthyes. Moronidae) blood cells

2008

Abstract To gain further insight into the role of cortisol in Wsh innate immune responses, we cloned and sequenced a 2592 bp cDNA from sea bass (Dicentrarchus labrax) peritoneal leukocytes (PCLs) encoding a glucocorticoid receptor (DlGR1). The deduced aminoacid sequence displayed that DlGR1 belong to a multigenic family of steroid hormone receptors, and exhibited high homology (80%) to the Burton’s mouth breeder (Haplochromis burtoni) HbGR1. The DlGR1 functional domains presented homologies with those of several vertebrate species. In situ hybridization assay revealed that DlGR1 was expressed in macrophages and neutrophils from the peritoneal cavity. Since in a previous paper, sea bass PCL …

Stress proteinSettore BIO/05 - ZoologiaFish blood cellCadmium
researchProduct

Inflammatory response of Ciona intestinalis involve enhanced D-galactoside-specific lectins and FACIT collagen expression.

2007

researchProduct

Effect of cadmium exposure on phagocytosis and plaque lysis activity of Paracentrotus lividus coelomocyte

2007

researchProduct

Cooperazione cellulare nella reazione citotossica dei celomociti di Paracentrotus lividus

2007

researchProduct

Anche i pesci si stressano

2008

researchProduct